FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631038_at:

>probe:Drosophila_2:1631038_at:323:3; Interrogation_Position=106; Antisense; ATTGGATTCTCCGATTGTTGTTGCT
>probe:Drosophila_2:1631038_at:296:721; Interrogation_Position=126; Antisense; TTGCTGCGAGCGGACGGAAGCTATC
>probe:Drosophila_2:1631038_at:183:205; Interrogation_Position=143; Antisense; AAGCTATCGGCCTGGCGGAAGTGAA
>probe:Drosophila_2:1631038_at:692:183; Interrogation_Position=17; Antisense; AACAACGCTTTTCTGACCGTGTGTC
>probe:Drosophila_2:1631038_at:343:475; Interrogation_Position=182; Antisense; GTTTTGGCCACGTGATCGGAAGGAA
>probe:Drosophila_2:1631038_at:275:389; Interrogation_Position=223; Antisense; GAAACATCCGATGCAGACGACAAGG
>probe:Drosophila_2:1631038_at:60:427; Interrogation_Position=253; Antisense; GAGATGTCTCGATGTCAGCAGCAGC
>probe:Drosophila_2:1631038_at:606:113; Interrogation_Position=269; Antisense; AGCAGCAGCGTACTTCGTACTTCGT
>probe:Drosophila_2:1631038_at:12:63; Interrogation_Position=306; Antisense; ATGTCCTCGAGTGTCCTCGGGCAAA
>probe:Drosophila_2:1631038_at:157:249; Interrogation_Position=341; Antisense; AATTGTCGGCTAATCTGTCGATGAC
>probe:Drosophila_2:1631038_at:36:517; Interrogation_Position=35; Antisense; GTGTGTCTGCGGACAACCGCTTAGA
>probe:Drosophila_2:1631038_at:619:597; Interrogation_Position=356; Antisense; TGTCGATGACTTTCACCCTCGAAAG
>probe:Drosophila_2:1631038_at:292:279; Interrogation_Position=406; Antisense; CCTCGAACCGTCAGATGGGAAATTT
>probe:Drosophila_2:1631038_at:185:201; Interrogation_Position=49; Antisense; AACCGCTTAGATGGAGAGCCGGACA

Paste this into a BLAST search page for me
ATTGGATTCTCCGATTGTTGTTGCTTTGCTGCGAGCGGACGGAAGCTATCAAGCTATCGGCCTGGCGGAAGTGAAAACAACGCTTTTCTGACCGTGTGTCGTTTTGGCCACGTGATCGGAAGGAAGAAACATCCGATGCAGACGACAAGGGAGATGTCTCGATGTCAGCAGCAGCAGCAGCAGCGTACTTCGTACTTCGTATGTCCTCGAGTGTCCTCGGGCAAAAATTGTCGGCTAATCTGTCGATGACGTGTGTCTGCGGACAACCGCTTAGATGTCGATGACTTTCACCCTCGAAAGCCTCGAACCGTCAGATGGGAAATTTAACCGCTTAGATGGAGAGCCGGACA

Full Affymetrix probeset data:

Annotations for 1631038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720