FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631039_at:

>probe:Drosophila_2:1631039_at:566:115; Interrogation_Position=339; Antisense; AGCATGTTGCTTGGTGGCAGTCCCA
>probe:Drosophila_2:1631039_at:550:259; Interrogation_Position=362; Antisense; CACGGCAGATGATCTCCTCAAGGAT
>probe:Drosophila_2:1631039_at:55:3; Interrogation_Position=437; Antisense; TTTGTTTGAACTGACCCGGAAGCAT
>probe:Drosophila_2:1631039_at:170:329; Interrogation_Position=477; Antisense; GCGTGTCAGTTGCATGTAGGTCCTT
>probe:Drosophila_2:1631039_at:237:679; Interrogation_Position=550; Antisense; TAGTGCCCTACGATGCCGATGTAAA
>probe:Drosophila_2:1631039_at:203:443; Interrogation_Position=567; Antisense; GATGTAAACCATGCGCCATGCGTTA
>probe:Drosophila_2:1631039_at:655:583; Interrogation_Position=637; Antisense; TGGACACGCAGGACCGGTTTTATGT
>probe:Drosophila_2:1631039_at:575:681; Interrogation_Position=657; Antisense; TATGTCCTGGCTCGTCATGGTAAAT
>probe:Drosophila_2:1631039_at:510:491; Interrogation_Position=676; Antisense; GTAAATCTCGTAACCTAGCCGTTTG
>probe:Drosophila_2:1631039_at:288:99; Interrogation_Position=767; Antisense; AGATGATGAGTTTCTGCTGCCACCG
>probe:Drosophila_2:1631039_at:101:367; Interrogation_Position=796; Antisense; GAATCGGTGGATCTCTGGGCCTCAA
>probe:Drosophila_2:1631039_at:107:653; Interrogation_Position=817; Antisense; TCAACGAGCGCTGCATTCTTGTCAA
>probe:Drosophila_2:1631039_at:398:345; Interrogation_Position=829; Antisense; GCATTCTTGTCAACGGGCTGCCAAA
>probe:Drosophila_2:1631039_at:94:459; Interrogation_Position=860; Antisense; GATTCATGTTCGCTGGTCCTAAATA

Paste this into a BLAST search page for me
AGCATGTTGCTTGGTGGCAGTCCCACACGGCAGATGATCTCCTCAAGGATTTTGTTTGAACTGACCCGGAAGCATGCGTGTCAGTTGCATGTAGGTCCTTTAGTGCCCTACGATGCCGATGTAAAGATGTAAACCATGCGCCATGCGTTATGGACACGCAGGACCGGTTTTATGTTATGTCCTGGCTCGTCATGGTAAATGTAAATCTCGTAACCTAGCCGTTTGAGATGATGAGTTTCTGCTGCCACCGGAATCGGTGGATCTCTGGGCCTCAATCAACGAGCGCTGCATTCTTGTCAAGCATTCTTGTCAACGGGCTGCCAAAGATTCATGTTCGCTGGTCCTAAATA

Full Affymetrix probeset data:

Annotations for 1631039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720