Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631040_at:

>probe:Drosophila_2:1631040_at:189:119; Interrogation_Position=1577; Antisense; AGCGGAATAAGTCCTCGAAGCGTTC
>probe:Drosophila_2:1631040_at:129:379; Interrogation_Position=1593; Antisense; GAAGCGTTCGTCCTATGCATCGAAT
>probe:Drosophila_2:1631040_at:612:241; Interrogation_Position=1615; Antisense; AATACCACCGATTCGCCGCGTGATT
>probe:Drosophila_2:1631040_at:546:193; Interrogation_Position=1654; Antisense; AACTCCAGCTCGAATCTGAATGGTG
>probe:Drosophila_2:1631040_at:313:521; Interrogation_Position=1676; Antisense; GTGGCTATAGCAGCATGCCTACGAC
>probe:Drosophila_2:1631040_at:681:295; Interrogation_Position=1703; Antisense; CGAATCAGTTGCGTGCTCCCAAGGG
>probe:Drosophila_2:1631040_at:548:315; Interrogation_Position=1768; Antisense; GCCTGCGGATTCGACTCAACCTGGT
>probe:Drosophila_2:1631040_at:652:199; Interrogation_Position=1785; Antisense; AACCTGGTCGGTCAATTGTCGCGGT
>probe:Drosophila_2:1631040_at:571:5; Interrogation_Position=1799; Antisense; ATTGTCGCGGTTCCTCGAGCAGCAA
>probe:Drosophila_2:1631040_at:590:225; Interrogation_Position=1822; Antisense; AATCCTTCGCAATCCTAATTACCTG
>probe:Drosophila_2:1631040_at:686:475; Interrogation_Position=1856; Antisense; GTTAGCACAGTCTACATACCACCAT
>probe:Drosophila_2:1631040_at:203:105; Interrogation_Position=1967; Antisense; AGACGTTACATTTTCTTGTGTTTGT
>probe:Drosophila_2:1631040_at:301:693; Interrogation_Position=2032; Antisense; TTTCCTATTTTGTGCCCTTTTCTAG
>probe:Drosophila_2:1631040_at:287:507; Interrogation_Position=2043; Antisense; GTGCCCTTTTCTAGGGACATCCAAT

Paste this into a BLAST search page for me
AGCGGAATAAGTCCTCGAAGCGTTCGAAGCGTTCGTCCTATGCATCGAATAATACCACCGATTCGCCGCGTGATTAACTCCAGCTCGAATCTGAATGGTGGTGGCTATAGCAGCATGCCTACGACCGAATCAGTTGCGTGCTCCCAAGGGGCCTGCGGATTCGACTCAACCTGGTAACCTGGTCGGTCAATTGTCGCGGTATTGTCGCGGTTCCTCGAGCAGCAAAATCCTTCGCAATCCTAATTACCTGGTTAGCACAGTCTACATACCACCATAGACGTTACATTTTCTTGTGTTTGTTTTCCTATTTTGTGCCCTTTTCTAGGTGCCCTTTTCTAGGGACATCCAAT

Full Affymetrix probeset data:

Annotations for 1631040_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime