FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631048_at:

>probe:Drosophila_2:1631048_at:232:431; Interrogation_Position=167; Antisense; GAGGGACGTCTTCTTTGAATCTCCG
>probe:Drosophila_2:1631048_at:669:237; Interrogation_Position=184; Antisense; AATCTCCGCTGGGTGGACGGCTTAA
>probe:Drosophila_2:1631048_at:563:405; Interrogation_Position=199; Antisense; GACGGCTTAAATTGCGCTACTTACA
>probe:Drosophila_2:1631048_at:309:245; Interrogation_Position=240; Antisense; CAATTGGTCTACTACGATCGTCCCG
>probe:Drosophila_2:1631048_at:13:503; Interrogation_Position=274; Antisense; GTCCCAAGCTTTCCAAGTTCAACAA
>probe:Drosophila_2:1631048_at:232:423; Interrogation_Position=327; Antisense; GAGAAGATCCTGAGCCAGTCGAACG
>probe:Drosophila_2:1631048_at:673:499; Interrogation_Position=344; Antisense; GTCGAACGGCGTACTTGGTGTCCTG
>probe:Drosophila_2:1631048_at:466:567; Interrogation_Position=379; Antisense; GGCACTTGTTCCTTTGCGGACAGAC
>probe:Drosophila_2:1631048_at:657:433; Interrogation_Position=486; Antisense; GAGGGTCAAGCCATTGCCGAGAAAC
>probe:Drosophila_2:1631048_at:79:71; Interrogation_Position=535; Antisense; AGGCGGACCTCATGATCGGCTCGTA
>probe:Drosophila_2:1631048_at:587:571; Interrogation_Position=552; Antisense; GGCTCGTATTTCGATGCTCTCAGAA
>probe:Drosophila_2:1631048_at:304:13; Interrogation_Position=593; Antisense; ATTCATTTTGTACATCCTCGTTAGG
>probe:Drosophila_2:1631048_at:179:635; Interrogation_Position=610; Antisense; TCGTTAGGATTAGTTCTGTACCCAA
>probe:Drosophila_2:1631048_at:485:593; Interrogation_Position=639; Antisense; TGGGACTCTGTCTTGTATCATAGAA

Paste this into a BLAST search page for me
GAGGGACGTCTTCTTTGAATCTCCGAATCTCCGCTGGGTGGACGGCTTAAGACGGCTTAAATTGCGCTACTTACACAATTGGTCTACTACGATCGTCCCGGTCCCAAGCTTTCCAAGTTCAACAAGAGAAGATCCTGAGCCAGTCGAACGGTCGAACGGCGTACTTGGTGTCCTGGGCACTTGTTCCTTTGCGGACAGACGAGGGTCAAGCCATTGCCGAGAAACAGGCGGACCTCATGATCGGCTCGTAGGCTCGTATTTCGATGCTCTCAGAAATTCATTTTGTACATCCTCGTTAGGTCGTTAGGATTAGTTCTGTACCCAATGGGACTCTGTCTTGTATCATAGAA

Full Affymetrix probeset data:

Annotations for 1631048_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720