Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631049_at:

>probe:Drosophila_2:1631049_at:39:21; Interrogation_Position=1644; Antisense; ATATGGTCTTTATCGGCGGAGCTGT
>probe:Drosophila_2:1631049_at:490:509; Interrogation_Position=1679; Antisense; GTGACAAAGGATCGCGACGGCTTCT
>probe:Drosophila_2:1631049_at:412:405; Interrogation_Position=1694; Antisense; GACGGCTTCTGGATGTCCAAGCAGG
>probe:Drosophila_2:1631049_at:622:71; Interrogation_Position=1725; Antisense; AGGAACAGGGTCTCAAAGTATTGCA
>probe:Drosophila_2:1631049_at:235:461; Interrogation_Position=1882; Antisense; GATTTACGTGATATATCCGTCTATA
>probe:Drosophila_2:1631049_at:208:467; Interrogation_Position=1950; Antisense; GTTGAGCAGGATTGGTCCACTTGCC
>probe:Drosophila_2:1631049_at:403:505; Interrogation_Position=1964; Antisense; GTCCACTTGCCCTTAGATTATCTAT
>probe:Drosophila_2:1631049_at:623:235; Interrogation_Position=1989; Antisense; AATCGCAGACATGTCGTCACTGGTC
>probe:Drosophila_2:1631049_at:202:143; Interrogation_Position=2007; Antisense; ACTGGTCGTTATCCCCGTACAATAT
>probe:Drosophila_2:1631049_at:612:387; Interrogation_Position=2054; Antisense; GAAAACTTTAATTCGATAGTCGCCT
>probe:Drosophila_2:1631049_at:414:501; Interrogation_Position=2072; Antisense; GTCGCCTAAATTGTGTAACCCTGCA
>probe:Drosophila_2:1631049_at:322:491; Interrogation_Position=2086; Antisense; GTAACCCTGCATTAGTGTGTTTAAT
>probe:Drosophila_2:1631049_at:725:711; Interrogation_Position=2199; Antisense; TTCAAAGCACCTCGAGTGCGGCGAT
>probe:Drosophila_2:1631049_at:313:295; Interrogation_Position=2211; Antisense; CGAGTGCGGCGATATTTTTGTAAAC

Paste this into a BLAST search page for me
ATATGGTCTTTATCGGCGGAGCTGTGTGACAAAGGATCGCGACGGCTTCTGACGGCTTCTGGATGTCCAAGCAGGAGGAACAGGGTCTCAAAGTATTGCAGATTTACGTGATATATCCGTCTATAGTTGAGCAGGATTGGTCCACTTGCCGTCCACTTGCCCTTAGATTATCTATAATCGCAGACATGTCGTCACTGGTCACTGGTCGTTATCCCCGTACAATATGAAAACTTTAATTCGATAGTCGCCTGTCGCCTAAATTGTGTAACCCTGCAGTAACCCTGCATTAGTGTGTTTAATTTCAAAGCACCTCGAGTGCGGCGATCGAGTGCGGCGATATTTTTGTAAAC

Full Affymetrix probeset data:

Annotations for 1631049_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime