FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631050_at:

>probe:Drosophila_2:1631050_at:557:129; Interrogation_Position=1031; Antisense; ACCGTACAATTCGTGCGCTTTCAAT
>probe:Drosophila_2:1631050_at:19:163; Interrogation_Position=1100; Antisense; AAATTCCCCATTGACTTCGATGCCT
>probe:Drosophila_2:1631050_at:40:119; Interrogation_Position=1155; Antisense; AGCTCTGCCCAATGCGTTCGAAATT
>probe:Drosophila_2:1631050_at:247:293; Interrogation_Position=1252; Antisense; CGTTAAGTACGAGCAGTTCTGGTTC
>probe:Drosophila_2:1631050_at:592:471; Interrogation_Position=1273; Antisense; GTTCGACGACGACTTGGGCAGCAAC
>probe:Drosophila_2:1631050_at:612:525; Interrogation_Position=1288; Antisense; GGGCAGCAACAATTCGGGATACTAT
>probe:Drosophila_2:1631050_at:472:715; Interrogation_Position=1300; Antisense; TTCGGGATACTATACGCTGCAGGCG
>probe:Drosophila_2:1631050_at:620:265; Interrogation_Position=1348; Antisense; CAGTTCGTCGGGTCATTATGTGGCC
>probe:Drosophila_2:1631050_at:293:263; Interrogation_Position=1384; Antisense; CAGCGGCGATGTGTGGTTCAAGTTC
>probe:Drosophila_2:1631050_at:46:59; Interrogation_Position=1410; Antisense; ATGATGATGAGGTCTCCGCCGTGGC
>probe:Drosophila_2:1631050_at:641:309; Interrogation_Position=1434; Antisense; CCACGGACGAGATTTTGCGGCTTTC
>probe:Drosophila_2:1631050_at:479:7; Interrogation_Position=1476; Antisense; ATTGCGCCTATGTCCTGTTATATGC
>probe:Drosophila_2:1631050_at:666:475; Interrogation_Position=1492; Antisense; GTTATATGCGCCCAGACGTTTGGAG
>probe:Drosophila_2:1631050_at:372:361; Interrogation_Position=996; Antisense; GAACTTACTTGGTGAGCCGACTTCC

Paste this into a BLAST search page for me
ACCGTACAATTCGTGCGCTTTCAATAAATTCCCCATTGACTTCGATGCCTAGCTCTGCCCAATGCGTTCGAAATTCGTTAAGTACGAGCAGTTCTGGTTCGTTCGACGACGACTTGGGCAGCAACGGGCAGCAACAATTCGGGATACTATTTCGGGATACTATACGCTGCAGGCGCAGTTCGTCGGGTCATTATGTGGCCCAGCGGCGATGTGTGGTTCAAGTTCATGATGATGAGGTCTCCGCCGTGGCCCACGGACGAGATTTTGCGGCTTTCATTGCGCCTATGTCCTGTTATATGCGTTATATGCGCCCAGACGTTTGGAGGAACTTACTTGGTGAGCCGACTTCC

Full Affymetrix probeset data:

Annotations for 1631050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720