Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631051_at:

>probe:Drosophila_2:1631051_at:431:153; Interrogation_Position=2554; Antisense; ACATGGCTCACTTGCGAAAATCACG
>probe:Drosophila_2:1631051_at:652:683; Interrogation_Position=2603; Antisense; TATCCACACCATGGCAACGGACGAT
>probe:Drosophila_2:1631051_at:428:437; Interrogation_Position=2625; Antisense; GATGGACGCCGCGTTAACTTTCATC
>probe:Drosophila_2:1631051_at:563:425; Interrogation_Position=2668; Antisense; GAGAGAGTGGCTTCGACTCGGCATA
>probe:Drosophila_2:1631051_at:62:669; Interrogation_Position=2691; Antisense; TACTTTGTCTACTTTCAGCGGCAGA
>probe:Drosophila_2:1631051_at:470:121; Interrogation_Position=2707; Antisense; AGCGGCAGAAGTCCACCGATCTTTT
>probe:Drosophila_2:1631051_at:526:161; Interrogation_Position=2745; Antisense; ACAATGGTTTTTCCCATGGCACTGA
>probe:Drosophila_2:1631051_at:394:269; Interrogation_Position=2759; Antisense; CATGGCACTGATCATTTTCGGAGAT
>probe:Drosophila_2:1631051_at:143:529; Interrogation_Position=2795; Antisense; GGGAGTGACCCAAAATACGCCATAT
>probe:Drosophila_2:1631051_at:669:27; Interrogation_Position=2809; Antisense; ATACGCCATATCTGTGCGTGGCCAA
>probe:Drosophila_2:1631051_at:160:217; Interrogation_Position=2853; Antisense; AATCGTGAAACTGCCGACGTAGTCA
>probe:Drosophila_2:1631051_at:453:363; Interrogation_Position=2979; Antisense; GAATTGCTTCTCTCGCTAGACGAAA
>probe:Drosophila_2:1631051_at:300:405; Interrogation_Position=3004; Antisense; GACTCGGCGAGGACTATATTTCATC
>probe:Drosophila_2:1631051_at:267:23; Interrogation_Position=3045; Antisense; ATATAATCTGCCTCCATAGCTTGGT

Paste this into a BLAST search page for me
ACATGGCTCACTTGCGAAAATCACGTATCCACACCATGGCAACGGACGATGATGGACGCCGCGTTAACTTTCATCGAGAGAGTGGCTTCGACTCGGCATATACTTTGTCTACTTTCAGCGGCAGAAGCGGCAGAAGTCCACCGATCTTTTACAATGGTTTTTCCCATGGCACTGACATGGCACTGATCATTTTCGGAGATGGGAGTGACCCAAAATACGCCATATATACGCCATATCTGTGCGTGGCCAAAATCGTGAAACTGCCGACGTAGTCAGAATTGCTTCTCTCGCTAGACGAAAGACTCGGCGAGGACTATATTTCATCATATAATCTGCCTCCATAGCTTGGT

Full Affymetrix probeset data:

Annotations for 1631051_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime