FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631052_at:

>probe:Drosophila_2:1631052_at:536:467; Interrogation_Position=115; Antisense; GTTGACCTCAGTCGTTTGAGCGAGA
>probe:Drosophila_2:1631052_at:492:451; Interrogation_Position=15; Antisense; GATCGTACTGATCGTGGTTTCAATC
>probe:Drosophila_2:1631052_at:441:263; Interrogation_Position=151; Antisense; CAGCTGGCTGAGCAGTTGGCAAAAT
>probe:Drosophila_2:1631052_at:358:547; Interrogation_Position=222; Antisense; GGATGACCCAGAACAGGATCAGCAG
>probe:Drosophila_2:1631052_at:306:131; Interrogation_Position=269; Antisense; ACCGCGGCGGAAGTCGTCCATGGAA
>probe:Drosophila_2:1631052_at:175:459; Interrogation_Position=341; Antisense; GATATCTCAAGAAGCTCCTAAGGCA
>probe:Drosophila_2:1631052_at:702:1; Interrogation_Position=372; Antisense; ATTGGCCCGGAGTGCTGGATATAGC
>probe:Drosophila_2:1631052_at:574:283; Interrogation_Position=396; Antisense; CGGTGTCCGGAGTGCGAACTTGACT
>probe:Drosophila_2:1631052_at:61:603; Interrogation_Position=41; Antisense; TGTTACCATCAATTCCGGAGGCTTC
>probe:Drosophila_2:1631052_at:270:147; Interrogation_Position=413; Antisense; ACTTGACTCCCCAGCTGGAGGAGTA
>probe:Drosophila_2:1631052_at:207:551; Interrogation_Position=432; Antisense; GGAGTACTACCTAATACCACTGCAG
>probe:Drosophila_2:1631052_at:455:341; Interrogation_Position=61; Antisense; GCTTCTGCCAAAGCCTGTGGATCGA
>probe:Drosophila_2:1631052_at:54:425; Interrogation_Position=84; Antisense; GAGACTCCAGTTGCGGGCTCAAAAT
>probe:Drosophila_2:1631052_at:543:571; Interrogation_Position=99; Antisense; GGCTCAAAATGATCCCGTTGACCTC

Paste this into a BLAST search page for me
GTTGACCTCAGTCGTTTGAGCGAGAGATCGTACTGATCGTGGTTTCAATCCAGCTGGCTGAGCAGTTGGCAAAATGGATGACCCAGAACAGGATCAGCAGACCGCGGCGGAAGTCGTCCATGGAAGATATCTCAAGAAGCTCCTAAGGCAATTGGCCCGGAGTGCTGGATATAGCCGGTGTCCGGAGTGCGAACTTGACTTGTTACCATCAATTCCGGAGGCTTCACTTGACTCCCCAGCTGGAGGAGTAGGAGTACTACCTAATACCACTGCAGGCTTCTGCCAAAGCCTGTGGATCGAGAGACTCCAGTTGCGGGCTCAAAATGGCTCAAAATGATCCCGTTGACCTC

Full Affymetrix probeset data:

Annotations for 1631052_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720