FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631053_at:

>probe:Drosophila_2:1631053_at:211:39; Interrogation_Position=103; Antisense; ATCTAGCCCTGGGTGGTGCCTGTGA
>probe:Drosophila_2:1631053_at:227:591; Interrogation_Position=116; Antisense; TGGTGCCTGTGAGTGCCAACCGTGT
>probe:Drosophila_2:1631053_at:413:299; Interrogation_Position=13; Antisense; CCATCTGGTAAAGTAGTCTCAATCT
>probe:Drosophila_2:1631053_at:30:313; Interrogation_Position=130; Antisense; GCCAACCGTGTGGTCCTGGTGGAAA
>probe:Drosophila_2:1631053_at:129:389; Interrogation_Position=174; Antisense; GAAAAGCCCCAACTTTGTCAGCAGC
>probe:Drosophila_2:1631053_at:554:727; Interrogation_Position=188; Antisense; TTGTCAGCAGCTCATTAGCGATATT
>probe:Drosophila_2:1631053_at:461:673; Interrogation_Position=203; Antisense; TAGCGATATTCGCAATCTCCAGCAG
>probe:Drosophila_2:1631053_at:171:363; Interrogation_Position=214; Antisense; GCAATCTCCAGCAGAAGATCCGGAA
>probe:Drosophila_2:1631053_at:172:97; Interrogation_Position=229; Antisense; AGATCCGGAAATGCGTCTGCGGAGA
>probe:Drosophila_2:1631053_at:70:329; Interrogation_Position=241; Antisense; GCGTCTGCGGAGAACCACAATGGAT
>probe:Drosophila_2:1631053_at:335:545; Interrogation_Position=262; Antisense; GGATGATTTAGACACCAATCACTTT
>probe:Drosophila_2:1631053_at:586:389; Interrogation_Position=50; Antisense; GAAACTGATCGCAGTCACCATCATC
>probe:Drosophila_2:1631053_at:164:271; Interrogation_Position=68; Antisense; CATCATCGCTTGCATCCTGCTCATT
>probe:Drosophila_2:1631053_at:169:619; Interrogation_Position=85; Antisense; TGCTCATTGGATTCTCCGATCTAGC

Paste this into a BLAST search page for me
ATCTAGCCCTGGGTGGTGCCTGTGATGGTGCCTGTGAGTGCCAACCGTGTCCATCTGGTAAAGTAGTCTCAATCTGCCAACCGTGTGGTCCTGGTGGAAAGAAAAGCCCCAACTTTGTCAGCAGCTTGTCAGCAGCTCATTAGCGATATTTAGCGATATTCGCAATCTCCAGCAGGCAATCTCCAGCAGAAGATCCGGAAAGATCCGGAAATGCGTCTGCGGAGAGCGTCTGCGGAGAACCACAATGGATGGATGATTTAGACACCAATCACTTTGAAACTGATCGCAGTCACCATCATCCATCATCGCTTGCATCCTGCTCATTTGCTCATTGGATTCTCCGATCTAGC

Full Affymetrix probeset data:

Annotations for 1631053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720