FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631055_at:

>probe:Drosophila_2:1631055_at:599:721; Interrogation_Position=2190; Antisense; TTGCCAACATTGGATTTCTCACCAC
>probe:Drosophila_2:1631055_at:224:19; Interrogation_Position=2203; Antisense; ATTTCTCACCACACACAACAATTTA
>probe:Drosophila_2:1631055_at:547:255; Interrogation_Position=2218; Antisense; CAACAATTTACATCAGCCATTTCCC
>probe:Drosophila_2:1631055_at:343:17; Interrogation_Position=2236; Antisense; ATTTCCCTCCGTGTTCATGTGGAAC
>probe:Drosophila_2:1631055_at:490:189; Interrogation_Position=2258; Antisense; AACAGTTCGAAGACACAAGCCGGAA
>probe:Drosophila_2:1631055_at:261:205; Interrogation_Position=2274; Antisense; AAGCCGGAACAACCTTTTCATCTAG
>probe:Drosophila_2:1631055_at:368:137; Interrogation_Position=2329; Antisense; ACGATTTGAAATCCGGATACCGCAA
>probe:Drosophila_2:1631055_at:516:115; Interrogation_Position=2412; Antisense; AGCGTATTTAACCACGAGACTACAG
>probe:Drosophila_2:1631055_at:485:363; Interrogation_Position=2581; Antisense; GAATTGTCATCTAAACCAGGGCTAA
>probe:Drosophila_2:1631055_at:183:273; Interrogation_Position=2613; Antisense; CATTTCATTTCGATCGATCGTACGA
>probe:Drosophila_2:1631055_at:624:405; Interrogation_Position=2628; Antisense; GATCGTACGATTCAGTTCGGTCAAC
>probe:Drosophila_2:1631055_at:645:93; Interrogation_Position=2641; Antisense; AGTTCGGTCAACTCAGTCAGCTGCA
>probe:Drosophila_2:1631055_at:235:89; Interrogation_Position=2655; Antisense; AGTCAGCTGCAGAAACATCAAGTTG
>probe:Drosophila_2:1631055_at:222:163; Interrogation_Position=2739; Antisense; AAATTATGGCGCACACAGTGTGCTT

Paste this into a BLAST search page for me
TTGCCAACATTGGATTTCTCACCACATTTCTCACCACACACAACAATTTACAACAATTTACATCAGCCATTTCCCATTTCCCTCCGTGTTCATGTGGAACAACAGTTCGAAGACACAAGCCGGAAAAGCCGGAACAACCTTTTCATCTAGACGATTTGAAATCCGGATACCGCAAAGCGTATTTAACCACGAGACTACAGGAATTGTCATCTAAACCAGGGCTAACATTTCATTTCGATCGATCGTACGAGATCGTACGATTCAGTTCGGTCAACAGTTCGGTCAACTCAGTCAGCTGCAAGTCAGCTGCAGAAACATCAAGTTGAAATTATGGCGCACACAGTGTGCTT

Full Affymetrix probeset data:

Annotations for 1631055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720