Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631058_s_at:

>probe:Drosophila_2:1631058_s_at:184:311; Interrogation_Position=274; Antisense; CCAAGCTGAAGGTCAAGTTCGACGA
>probe:Drosophila_2:1631058_s_at:716:635; Interrogation_Position=292; Antisense; TCGACGATCCGAACGTGGAGCGTGT
>probe:Drosophila_2:1631058_s_at:467:139; Interrogation_Position=304; Antisense; ACGTGGAGCGTGTGCGCCGTGCCCA
>probe:Drosophila_2:1631058_s_at:530:507; Interrogation_Position=322; Antisense; GTGCCCACCGCAACGACCTGGAGAA
>probe:Drosophila_2:1631058_s_at:187:133; Interrogation_Position=328; Antisense; ACCGCAACGACCTGGAGAACATCCT
>probe:Drosophila_2:1631058_s_at:568:41; Interrogation_Position=366; Antisense; ATCGGTCTGCTCTACGTCCTGACTG
>probe:Drosophila_2:1631058_s_at:64:619; Interrogation_Position=373; Antisense; TGCTCTACGTCCTGACTGATCCGGC
>probe:Drosophila_2:1631058_s_at:641:497; Interrogation_Position=528; Antisense; GTCTACATGGCCCTGCAGGTCATCG
>probe:Drosophila_2:1631058_s_at:125:641; Interrogation_Position=555; Antisense; TCGGCCGCCTTCTGAGCACATAGGT
>probe:Drosophila_2:1631058_s_at:443:299; Interrogation_Position=560; Antisense; CGCCTTCTGAGCACATAGGTCTAGT
>probe:Drosophila_2:1631058_s_at:496:419; Interrogation_Position=568; Antisense; GAGCACATAGGTCTAGTCCTTCTTG
>probe:Drosophila_2:1631058_s_at:423:271; Interrogation_Position=573; Antisense; CATAGGTCTAGTCCTTCTTGTTTTT
>probe:Drosophila_2:1631058_s_at:16:243; Interrogation_Position=627; Antisense; AATATAGAGTTACGCCTACCTCGGC
>probe:Drosophila_2:1631058_s_at:158:677; Interrogation_Position=631; Antisense; TAGAGTTACGCCTACCTCGGCTTTG

Paste this into a BLAST search page for me
CCAAGCTGAAGGTCAAGTTCGACGATCGACGATCCGAACGTGGAGCGTGTACGTGGAGCGTGTGCGCCGTGCCCAGTGCCCACCGCAACGACCTGGAGAAACCGCAACGACCTGGAGAACATCCTATCGGTCTGCTCTACGTCCTGACTGTGCTCTACGTCCTGACTGATCCGGCGTCTACATGGCCCTGCAGGTCATCGTCGGCCGCCTTCTGAGCACATAGGTCGCCTTCTGAGCACATAGGTCTAGTGAGCACATAGGTCTAGTCCTTCTTGCATAGGTCTAGTCCTTCTTGTTTTTAATATAGAGTTACGCCTACCTCGGCTAGAGTTACGCCTACCTCGGCTTTG

Full Affymetrix probeset data:

Annotations for 1631058_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime