Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631059_at:

>probe:Drosophila_2:1631059_at:346:309; Interrogation_Position=3073; Antisense; CCAGTGGCTGAGTGCATTTTGTTAT
>probe:Drosophila_2:1631059_at:450:465; Interrogation_Position=3110; Antisense; GATTGTTTGACGTGCCGAATCTCAA
>probe:Drosophila_2:1631059_at:368:367; Interrogation_Position=3126; Antisense; GAATCTCAAGTTTCGCACTCGCAGA
>probe:Drosophila_2:1631059_at:591:103; Interrogation_Position=3148; Antisense; AGACCGACAGCATCCAACCAGAGAT
>probe:Drosophila_2:1631059_at:215:203; Interrogation_Position=3163; Antisense; AACCAGAGATCTATTTACGGGAGGC
>probe:Drosophila_2:1631059_at:246:699; Interrogation_Position=3176; Antisense; TTTACGGGAGGCGAGGCACTTGCTC
>probe:Drosophila_2:1631059_at:486:355; Interrogation_Position=3191; Antisense; GCACTTGCTCCAAGCGAATCTCAAG
>probe:Drosophila_2:1631059_at:203:525; Interrogation_Position=3215; Antisense; GGGAATTCCTAACACAATAGCCGAA
>probe:Drosophila_2:1631059_at:406:241; Interrogation_Position=3230; Antisense; AATAGCCGAAATGTGCCGTCTGTAC
>probe:Drosophila_2:1631059_at:717:499; Interrogation_Position=3247; Antisense; GTCTGTACCACAAACACCACACAAT
>probe:Drosophila_2:1631059_at:17:241; Interrogation_Position=3269; Antisense; AATACATGCGACCACACGGATCTAG
>probe:Drosophila_2:1631059_at:608:259; Interrogation_Position=3283; Antisense; CACGGATCTAGTTTCATTTGTTTTA
>probe:Drosophila_2:1631059_at:305:713; Interrogation_Position=3312; Antisense; TTCGAAATCTTGCACAACTTCCTTC
>probe:Drosophila_2:1631059_at:17:357; Interrogation_Position=3323; Antisense; GCACAACTTCCTTCTCAAGTATTAA

Paste this into a BLAST search page for me
CCAGTGGCTGAGTGCATTTTGTTATGATTGTTTGACGTGCCGAATCTCAAGAATCTCAAGTTTCGCACTCGCAGAAGACCGACAGCATCCAACCAGAGATAACCAGAGATCTATTTACGGGAGGCTTTACGGGAGGCGAGGCACTTGCTCGCACTTGCTCCAAGCGAATCTCAAGGGGAATTCCTAACACAATAGCCGAAAATAGCCGAAATGTGCCGTCTGTACGTCTGTACCACAAACACCACACAATAATACATGCGACCACACGGATCTAGCACGGATCTAGTTTCATTTGTTTTATTCGAAATCTTGCACAACTTCCTTCGCACAACTTCCTTCTCAAGTATTAA

Full Affymetrix probeset data:

Annotations for 1631059_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime