FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631060_at:

>probe:Drosophila_2:1631060_at:5:663; Interrogation_Position=3914; Antisense; TAACACTAATCCATTCTCGACCTTT
>probe:Drosophila_2:1631060_at:570:281; Interrogation_Position=3929; Antisense; CTCGACCTTTTTTCGAAGCCACAAG
>probe:Drosophila_2:1631060_at:363:311; Interrogation_Position=3946; Antisense; GCCACAAGTGTTTATTCCTAATCGA
>probe:Drosophila_2:1631060_at:448:345; Interrogation_Position=3976; Antisense; GCATTAGTTTTTTATTCGCGCTGTT
>probe:Drosophila_2:1631060_at:486:633; Interrogation_Position=3991; Antisense; TCGCGCTGTTTTTCTCGATTGGAAA
>probe:Drosophila_2:1631060_at:360:309; Interrogation_Position=4042; Antisense; CCAACAATGTTATCTGGTCCATGAA
>probe:Drosophila_2:1631060_at:540:9; Interrogation_Position=4071; Antisense; ATTCGCTATTATTATGCCTGTTAAG
>probe:Drosophila_2:1631060_at:378:221; Interrogation_Position=4093; Antisense; AAGTGGCGAGTTTCCAACACAATCA
>probe:Drosophila_2:1631060_at:706:201; Interrogation_Position=4264; Antisense; AACCTCTAGAGCGATTTTCACATAC
>probe:Drosophila_2:1631060_at:318:697; Interrogation_Position=4279; Antisense; TTTCACATACTGCATTTCCCGCGTT
>probe:Drosophila_2:1631060_at:677:17; Interrogation_Position=4313; Antisense; ATTTCCGCATTAATTTCCGCATTTC
>probe:Drosophila_2:1631060_at:336:565; Interrogation_Position=4361; Antisense; GGCAAGCAAGCGTTTTAATCGCGAT
>probe:Drosophila_2:1631060_at:44:45; Interrogation_Position=4378; Antisense; ATCGCGATTGACTTTGTGGACTTAA
>probe:Drosophila_2:1631060_at:664:347; Interrogation_Position=4448; Antisense; GCATGTTACTAAATCGATTCGTGTG

Paste this into a BLAST search page for me
TAACACTAATCCATTCTCGACCTTTCTCGACCTTTTTTCGAAGCCACAAGGCCACAAGTGTTTATTCCTAATCGAGCATTAGTTTTTTATTCGCGCTGTTTCGCGCTGTTTTTCTCGATTGGAAACCAACAATGTTATCTGGTCCATGAAATTCGCTATTATTATGCCTGTTAAGAAGTGGCGAGTTTCCAACACAATCAAACCTCTAGAGCGATTTTCACATACTTTCACATACTGCATTTCCCGCGTTATTTCCGCATTAATTTCCGCATTTCGGCAAGCAAGCGTTTTAATCGCGATATCGCGATTGACTTTGTGGACTTAAGCATGTTACTAAATCGATTCGTGTG

Full Affymetrix probeset data:

Annotations for 1631060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720