FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631062_at:

>probe:Drosophila_2:1631062_at:578:255; Interrogation_Position=219; Antisense; CAAACTGTCTGCTATCCGCAAAAGC
>probe:Drosophila_2:1631062_at:391:103; Interrogation_Position=279; Antisense; AGACTCTGCGCTGGCCAATGAAGTG
>probe:Drosophila_2:1631062_at:58:85; Interrogation_Position=300; Antisense; AGTGGACGACCACCGTGATCAGTTC
>probe:Drosophila_2:1631062_at:718:453; Interrogation_Position=316; Antisense; GATCAGTTCTCCAAAACGCTGCAGG
>probe:Drosophila_2:1631062_at:692:133; Interrogation_Position=331; Antisense; ACGCTGCAGGCGTTCCGAAAAGCAA
>probe:Drosophila_2:1631062_at:571:295; Interrogation_Position=417; Antisense; CGAGAGTGAGCTACGCCAACGAACC
>probe:Drosophila_2:1631062_at:338:215; Interrogation_Position=502; Antisense; AAGATGCTGGCTATATCGCGGCACC
>probe:Drosophila_2:1631062_at:442:109; Interrogation_Position=542; Antisense; AGAAGAGCGCCATCACCCTGGAAAC
>probe:Drosophila_2:1631062_at:319:639; Interrogation_Position=569; Antisense; TCGTGGCCTCGTCGCAAAATGTGGA
>probe:Drosophila_2:1631062_at:724:567; Interrogation_Position=625; Antisense; GGCAGCATTAGCATGTCCGGCAAGC
>probe:Drosophila_2:1631062_at:170:557; Interrogation_Position=664; Antisense; GGACGACGCGAGTGCACTGACAAAA
>probe:Drosophila_2:1631062_at:340:285; Interrogation_Position=680; Antisense; CTGACAAAATGCTGCTCTTCTTCGC
>probe:Drosophila_2:1631062_at:309:317; Interrogation_Position=721; Antisense; GCCTGTGTCTTTTACATCGTCCAAA
>probe:Drosophila_2:1631062_at:113:147; Interrogation_Position=734; Antisense; ACATCGTCCAAAAGCGACTCTTCTA

Paste this into a BLAST search page for me
CAAACTGTCTGCTATCCGCAAAAGCAGACTCTGCGCTGGCCAATGAAGTGAGTGGACGACCACCGTGATCAGTTCGATCAGTTCTCCAAAACGCTGCAGGACGCTGCAGGCGTTCCGAAAAGCAACGAGAGTGAGCTACGCCAACGAACCAAGATGCTGGCTATATCGCGGCACCAGAAGAGCGCCATCACCCTGGAAACTCGTGGCCTCGTCGCAAAATGTGGAGGCAGCATTAGCATGTCCGGCAAGCGGACGACGCGAGTGCACTGACAAAACTGACAAAATGCTGCTCTTCTTCGCGCCTGTGTCTTTTACATCGTCCAAAACATCGTCCAAAAGCGACTCTTCTA

Full Affymetrix probeset data:

Annotations for 1631062_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720