FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631063_at:

>probe:Drosophila_2:1631063_at:504:639; Interrogation_Position=1005; Antisense; TCGTGCTCAACGAGTTCTCACAATT
>probe:Drosophila_2:1631063_at:240:275; Interrogation_Position=1041; Antisense; CTTTTCCCCATCATTAGAGACTCTA
>probe:Drosophila_2:1631063_at:133:425; Interrogation_Position=1057; Antisense; GAGACTCTAACTTCGATTTTGCGCT
>probe:Drosophila_2:1631063_at:167:17; Interrogation_Position=1072; Antisense; ATTTTGCGCTTCACTGGATCTCTGA
>probe:Drosophila_2:1631063_at:664:721; Interrogation_Position=1097; Antisense; TTGCCCTGGCAAAGTCGGTTATATA
>probe:Drosophila_2:1631063_at:177:541; Interrogation_Position=560; Antisense; GGTTCTGTTTGTACTTCACTGTTTT
>probe:Drosophila_2:1631063_at:565:41; Interrogation_Position=634; Antisense; ATCGAGAAGAGTCCCTCCGAAGCGG
>probe:Drosophila_2:1631063_at:708:71; Interrogation_Position=659; Antisense; AGGAAGCTCGCATAGTTCGGGAAAT
>probe:Drosophila_2:1631063_at:326:579; Interrogation_Position=761; Antisense; TGGCCCACTTTGTTACTTCGAGTTT
>probe:Drosophila_2:1631063_at:289:631; Interrogation_Position=823; Antisense; TCCGGCCTGGGAATCATTGTGTATG
>probe:Drosophila_2:1631063_at:446:485; Interrogation_Position=843; Antisense; GTATGTGGTCTACACTTGTGCCGTA
>probe:Drosophila_2:1631063_at:27:563; Interrogation_Position=912; Antisense; GGAAGCGTGTTCCAATCTAGCGCGC
>probe:Drosophila_2:1631063_at:320:679; Interrogation_Position=958; Antisense; TATGGCCACAGTGTTCGGGTCCAAA
>probe:Drosophila_2:1631063_at:223:609; Interrogation_Position=986; Antisense; TGACCCTTTTGATGGTAGCTCGTGC

Paste this into a BLAST search page for me
TCGTGCTCAACGAGTTCTCACAATTCTTTTCCCCATCATTAGAGACTCTAGAGACTCTAACTTCGATTTTGCGCTATTTTGCGCTTCACTGGATCTCTGATTGCCCTGGCAAAGTCGGTTATATAGGTTCTGTTTGTACTTCACTGTTTTATCGAGAAGAGTCCCTCCGAAGCGGAGGAAGCTCGCATAGTTCGGGAAATTGGCCCACTTTGTTACTTCGAGTTTTCCGGCCTGGGAATCATTGTGTATGGTATGTGGTCTACACTTGTGCCGTAGGAAGCGTGTTCCAATCTAGCGCGCTATGGCCACAGTGTTCGGGTCCAAATGACCCTTTTGATGGTAGCTCGTGC

Full Affymetrix probeset data:

Annotations for 1631063_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720