FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631065_at:

>probe:Drosophila_2:1631065_at:559:521; Interrogation_Position=15; Antisense; GGCACCTTCGAACATGGATTACCAC
>probe:Drosophila_2:1631065_at:397:579; Interrogation_Position=170; Antisense; GGCCATATGCCCTCAGCGAAAATAC
>probe:Drosophila_2:1631065_at:690:161; Interrogation_Position=189; Antisense; AAATACACCACGAAAGCGTCGCCAG
>probe:Drosophila_2:1631065_at:139:447; Interrogation_Position=237; Antisense; GATGCAGGAGCAACCATTGTACCAT
>probe:Drosophila_2:1631065_at:154:5; Interrogation_Position=252; Antisense; ATTGTACCATCACCACTCATTGCCT
>probe:Drosophila_2:1631065_at:355:589; Interrogation_Position=29; Antisense; TGGATTACCACAACGAGTCGGAAGT
>probe:Drosophila_2:1631065_at:62:653; Interrogation_Position=374; Antisense; TCAATCACCAGGCATACGCTTACAT
>probe:Drosophila_2:1631065_at:380:209; Interrogation_Position=406; Antisense; AAGCAACGTGCCGTGCTCCAGATGC
>probe:Drosophila_2:1631065_at:507:619; Interrogation_Position=419; Antisense; TGCTCCAGATGCGTCAACTGCTCAA
>probe:Drosophila_2:1631065_at:198:653; Interrogation_Position=432; Antisense; TCAACTGCTCAACATCAATCCGGAT
>probe:Drosophila_2:1631065_at:116:157; Interrogation_Position=461; Antisense; ACACCTGGCCACTGGAATGGCGCCA
>probe:Drosophila_2:1631065_at:107:375; Interrogation_Position=49; Antisense; GAAGTTGGCGAGAGCTACACCCACA
>probe:Drosophila_2:1631065_at:134:251; Interrogation_Position=72; Antisense; CAAGAAGTTCAAAACCGCCGGCTAT
>probe:Drosophila_2:1631065_at:118:301; Interrogation_Position=86; Antisense; CCGCCGGCTATACGCACAAAAAGTT

Paste this into a BLAST search page for me
GGCACCTTCGAACATGGATTACCACGGCCATATGCCCTCAGCGAAAATACAAATACACCACGAAAGCGTCGCCAGGATGCAGGAGCAACCATTGTACCATATTGTACCATCACCACTCATTGCCTTGGATTACCACAACGAGTCGGAAGTTCAATCACCAGGCATACGCTTACATAAGCAACGTGCCGTGCTCCAGATGCTGCTCCAGATGCGTCAACTGCTCAATCAACTGCTCAACATCAATCCGGATACACCTGGCCACTGGAATGGCGCCAGAAGTTGGCGAGAGCTACACCCACACAAGAAGTTCAAAACCGCCGGCTATCCGCCGGCTATACGCACAAAAAGTT

Full Affymetrix probeset data:

Annotations for 1631065_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720