FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631066_at:

>probe:Drosophila_2:1631066_at:506:449; Interrogation_Position=3374; Antisense; GATCCCACTTGAACAGAACTACCTC
>probe:Drosophila_2:1631066_at:241:27; Interrogation_Position=3401; Antisense; ATAGCGTATCTTTGTTAGCCTCATG
>probe:Drosophila_2:1631066_at:98:675; Interrogation_Position=3416; Antisense; TAGCCTCATGTTATCCTGTTAGCGA
>probe:Drosophila_2:1631066_at:366:459; Interrogation_Position=3441; Antisense; GATATTTAAATCGTCCTGGGTTGAA
>probe:Drosophila_2:1631066_at:542:211; Interrogation_Position=3471; Antisense; AAGACTGACACCGACTCAAACGTAC
>probe:Drosophila_2:1631066_at:338:487; Interrogation_Position=3492; Antisense; GTACCACGAGCAAGAGCACACGCAT
>probe:Drosophila_2:1631066_at:664:25; Interrogation_Position=3554; Antisense; ATACGAATCGAGATCCTTAGTTGAA
>probe:Drosophila_2:1631066_at:607:163; Interrogation_Position=3578; Antisense; AAATCTGTAAGTTTCCCGCAAATTG
>probe:Drosophila_2:1631066_at:508:457; Interrogation_Position=3607; Antisense; GTTCTAAGGCCATCAACTAAACGTA
>probe:Drosophila_2:1631066_at:173:527; Interrogation_Position=3706; Antisense; GGGCAATGCAATAGGCTCTTTAATT
>probe:Drosophila_2:1631066_at:125:357; Interrogation_Position=3749; Antisense; GCAACTTATATAGTCGTACGGTCGA
>probe:Drosophila_2:1631066_at:523:489; Interrogation_Position=3803; Antisense; GTACATAGCATCATAGTCCACACAT
>probe:Drosophila_2:1631066_at:382:705; Interrogation_Position=3879; Antisense; TTAAATTATCCCTAGACACCCGACT
>probe:Drosophila_2:1631066_at:41:107; Interrogation_Position=3892; Antisense; AGACACCCGACTTTCATCATGTAAA

Paste this into a BLAST search page for me
GATCCCACTTGAACAGAACTACCTCATAGCGTATCTTTGTTAGCCTCATGTAGCCTCATGTTATCCTGTTAGCGAGATATTTAAATCGTCCTGGGTTGAAAAGACTGACACCGACTCAAACGTACGTACCACGAGCAAGAGCACACGCATATACGAATCGAGATCCTTAGTTGAAAAATCTGTAAGTTTCCCGCAAATTGGTTCTAAGGCCATCAACTAAACGTAGGGCAATGCAATAGGCTCTTTAATTGCAACTTATATAGTCGTACGGTCGAGTACATAGCATCATAGTCCACACATTTAAATTATCCCTAGACACCCGACTAGACACCCGACTTTCATCATGTAAA

Full Affymetrix probeset data:

Annotations for 1631066_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720