FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631067_at:

>probe:Drosophila_2:1631067_at:294:165; Interrogation_Position=529; Antisense; AAATCTCTGTACTGCCTTTCGTGTC
>probe:Drosophila_2:1631067_at:459:629; Interrogation_Position=552; Antisense; TCCAGCTTCTGGTCGAGATCGAGCA
>probe:Drosophila_2:1631067_at:44:679; Interrogation_Position=587; Antisense; TAGGACTTCCGATCTGTTGCAGGAC
>probe:Drosophila_2:1631067_at:80:435; Interrogation_Position=645; Antisense; GAGGATACTGACTCGGCCAACGTCT
>probe:Drosophila_2:1631067_at:468:311; Interrogation_Position=660; Antisense; GCCAACGTCTCTGTCCAAAATCTGT
>probe:Drosophila_2:1631067_at:142:185; Interrogation_Position=676; Antisense; AAAATCTGTCCAGTGGTTCCAGTCC
>probe:Drosophila_2:1631067_at:423:85; Interrogation_Position=696; Antisense; AGTCCCGTTGGCAGCTTAGAGCACC
>probe:Drosophila_2:1631067_at:601:511; Interrogation_Position=724; Antisense; GTGACGACTCTGAGGAGCTTCTGGT
>probe:Drosophila_2:1631067_at:679:419; Interrogation_Position=783; Antisense; GAGCAGTTCCAGAGCGACGTGTCGT
>probe:Drosophila_2:1631067_at:688:515; Interrogation_Position=801; Antisense; GTGTCGTCGGAATCACCCAGGATAA
>probe:Drosophila_2:1631067_at:70:305; Interrogation_Position=833; Antisense; CCGACCTCAGCGCAAGTTCAAGAAT
>probe:Drosophila_2:1631067_at:531:209; Interrogation_Position=852; Antisense; AAGAATGCCATTGCTATTGCCTCCG
>probe:Drosophila_2:1631067_at:454:71; Interrogation_Position=949; Antisense; AGGAAGTGCGTCAGCAGCGTCAACC
>probe:Drosophila_2:1631067_at:172:633; Interrogation_Position=983; Antisense; TCGCCGTCTTTTAGCACAATCATTT

Paste this into a BLAST search page for me
AAATCTCTGTACTGCCTTTCGTGTCTCCAGCTTCTGGTCGAGATCGAGCATAGGACTTCCGATCTGTTGCAGGACGAGGATACTGACTCGGCCAACGTCTGCCAACGTCTCTGTCCAAAATCTGTAAAATCTGTCCAGTGGTTCCAGTCCAGTCCCGTTGGCAGCTTAGAGCACCGTGACGACTCTGAGGAGCTTCTGGTGAGCAGTTCCAGAGCGACGTGTCGTGTGTCGTCGGAATCACCCAGGATAACCGACCTCAGCGCAAGTTCAAGAATAAGAATGCCATTGCTATTGCCTCCGAGGAAGTGCGTCAGCAGCGTCAACCTCGCCGTCTTTTAGCACAATCATTT

Full Affymetrix probeset data:

Annotations for 1631067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720