Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631069_a_at:

>probe:Drosophila_2:1631069_a_at:522:557; Interrogation_Position=309; Antisense; GGACATACCGGCAACCAGCGAAGGT
>probe:Drosophila_2:1631069_a_at:90:91; Interrogation_Position=362; Antisense; AGTATCAGCAGCCAACTCCGGAGTT
>probe:Drosophila_2:1631069_a_at:503:531; Interrogation_Position=411; Antisense; GGTGGACCAATTGCGAACTTACCAT
>probe:Drosophila_2:1631069_a_at:616:561; Interrogation_Position=438; Antisense; GGAACTTCCCGAAAACTTGCAGACA
>probe:Drosophila_2:1631069_a_at:703:105; Interrogation_Position=458; Antisense; AGACACGCATTTCCTACGATCTACT
>probe:Drosophila_2:1631069_a_at:219:133; Interrogation_Position=484; Antisense; ACCGAACTCGCCAATTGTGTGCTAA
>probe:Drosophila_2:1631069_a_at:636:227; Interrogation_Position=540; Antisense; AATGGAGCTGCAACACGAAACCGAA
>probe:Drosophila_2:1631069_a_at:504:93; Interrogation_Position=653; Antisense; AGTTGCGCCACATTTTGGGACTCAT
>probe:Drosophila_2:1631069_a_at:468:541; Interrogation_Position=744; Antisense; GGTTAATGACCAACAATCCACACTT
>probe:Drosophila_2:1631069_a_at:400:235; Interrogation_Position=758; Antisense; AATCCACACTTCAAAAGGCCGGCGT
>probe:Drosophila_2:1631069_a_at:455:717; Interrogation_Position=782; Antisense; TTCCCGGCTTCTATGTCACCGAGAA
>probe:Drosophila_2:1631069_a_at:373:61; Interrogation_Position=794; Antisense; ATGTCACCGAGAATCCCAAGGAGAT
>probe:Drosophila_2:1631069_a_at:443:157; Interrogation_Position=825; Antisense; ACAAATGTTCCTGTTGGACTTCATT
>probe:Drosophila_2:1631069_a_at:80:647; Interrogation_Position=845; Antisense; TCATTTTGCGTTTGAGCCGGCTAAA

Paste this into a BLAST search page for me
GGACATACCGGCAACCAGCGAAGGTAGTATCAGCAGCCAACTCCGGAGTTGGTGGACCAATTGCGAACTTACCATGGAACTTCCCGAAAACTTGCAGACAAGACACGCATTTCCTACGATCTACTACCGAACTCGCCAATTGTGTGCTAAAATGGAGCTGCAACACGAAACCGAAAGTTGCGCCACATTTTGGGACTCATGGTTAATGACCAACAATCCACACTTAATCCACACTTCAAAAGGCCGGCGTTTCCCGGCTTCTATGTCACCGAGAAATGTCACCGAGAATCCCAAGGAGATACAAATGTTCCTGTTGGACTTCATTTCATTTTGCGTTTGAGCCGGCTAAA

Full Affymetrix probeset data:

Annotations for 1631069_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime