FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631072_at:

>probe:Drosophila_2:1631072_at:390:693; Interrogation_Position=1507; Antisense; TTTGCTGCATCTGAAGCCATTCTCG
>probe:Drosophila_2:1631072_at:445:269; Interrogation_Position=1524; Antisense; CATTCTCGGCGGGAAGTTTGACCTT
>probe:Drosophila_2:1631072_at:205:481; Interrogation_Position=1539; Antisense; GTTTGACCTTGCAATCTGCGAACTA
>probe:Drosophila_2:1631072_at:380:385; Interrogation_Position=1558; Antisense; GAACTATTTGGACGCTCCGATCATC
>probe:Drosophila_2:1631072_at:360:131; Interrogation_Position=1598; Antisense; ACCGATGAGCGCGATGTAGACACCT
>probe:Drosophila_2:1631072_at:401:149; Interrogation_Position=1650; Antisense; ACTTGCCGAATACCAAAGCCTTCAG
>probe:Drosophila_2:1631072_at:482:437; Interrogation_Position=1709; Antisense; GAGGCATGCAATGGTCTGACCTATC
>probe:Drosophila_2:1631072_at:203:89; Interrogation_Position=1734; Antisense; AGTCGGATGACTACTGGCGTTGCTA
>probe:Drosophila_2:1631072_at:714:581; Interrogation_Position=1748; Antisense; TGGCGTTGCTATATCCGTCACATGA
>probe:Drosophila_2:1631072_at:209:519; Interrogation_Position=1835; Antisense; GTGGTCGATCCCCAATTGAGGGTTC
>probe:Drosophila_2:1631072_at:467:465; Interrogation_Position=1872; Antisense; GATTGAGGGTGATCGATGCCAGCAT
>probe:Drosophila_2:1631072_at:623:49; Interrogation_Position=1898; Antisense; ATGCCCGACATTGTGGGTGCCAACA
>probe:Drosophila_2:1631072_at:123:53; Interrogation_Position=1926; Antisense; ATGCTGCATGCATTATGATCGCCGA
>probe:Drosophila_2:1631072_at:5:657; Interrogation_Position=2006; Antisense; TAAGCTCAGCGATATTTTACGACAT

Paste this into a BLAST search page for me
TTTGCTGCATCTGAAGCCATTCTCGCATTCTCGGCGGGAAGTTTGACCTTGTTTGACCTTGCAATCTGCGAACTAGAACTATTTGGACGCTCCGATCATCACCGATGAGCGCGATGTAGACACCTACTTGCCGAATACCAAAGCCTTCAGGAGGCATGCAATGGTCTGACCTATCAGTCGGATGACTACTGGCGTTGCTATGGCGTTGCTATATCCGTCACATGAGTGGTCGATCCCCAATTGAGGGTTCGATTGAGGGTGATCGATGCCAGCATATGCCCGACATTGTGGGTGCCAACAATGCTGCATGCATTATGATCGCCGATAAGCTCAGCGATATTTTACGACAT

Full Affymetrix probeset data:

Annotations for 1631072_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720