FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631073_at:

>probe:Drosophila_2:1631073_at:299:257; Interrogation_Position=1072; Antisense; CACGTTTACCACATACATTCCAATT
>probe:Drosophila_2:1631073_at:314:485; Interrogation_Position=1108; Antisense; GTAGGTTTCCTATGGAGCAGATCCA
>probe:Drosophila_2:1631073_at:635:481; Interrogation_Position=1160; Antisense; GTATACAGCAATCGCAACCACAATA
>probe:Drosophila_2:1631073_at:139:709; Interrogation_Position=1239; Antisense; TTAACGGATATAACTACCCATGCAT
>probe:Drosophila_2:1631073_at:346:221; Interrogation_Position=1317; Antisense; AAGTGTTCTTTAAGCAGCCGCGTTG
>probe:Drosophila_2:1631073_at:672:469; Interrogation_Position=1338; Antisense; GTTGCCTTTCTTCAGCTATGCTTAA
>probe:Drosophila_2:1631073_at:248:63; Interrogation_Position=839; Antisense; ATGTGCTGCTTCGACTGTGAGCTGA
>probe:Drosophila_2:1631073_at:248:113; Interrogation_Position=876; Antisense; AGCACATCCGTGTGGCGGGCAAGTA
>probe:Drosophila_2:1631073_at:358:489; Interrogation_Position=898; Antisense; GTACTTTGTCGACTTTGAAATCCCG
>probe:Drosophila_2:1631073_at:722:687; Interrogation_Position=911; Antisense; TTTGAAATCCCGACGCACTTGACGG
>probe:Drosophila_2:1631073_at:21:611; Interrogation_Position=930; Antisense; TGACGGCCCTGTGGCGCTACATGTA
>probe:Drosophila_2:1631073_at:287:601; Interrogation_Position=951; Antisense; TGTATCACATGTACCAGCTGGACGC
>probe:Drosophila_2:1631073_at:184:121; Interrogation_Position=966; Antisense; AGCTGGACGCCTTCACACAATCGTG
>probe:Drosophila_2:1631073_at:321:577; Interrogation_Position=994; Antisense; GGCCGACCAGGACATTATCAATCAC

Paste this into a BLAST search page for me
CACGTTTACCACATACATTCCAATTGTAGGTTTCCTATGGAGCAGATCCAGTATACAGCAATCGCAACCACAATATTAACGGATATAACTACCCATGCATAAGTGTTCTTTAAGCAGCCGCGTTGGTTGCCTTTCTTCAGCTATGCTTAAATGTGCTGCTTCGACTGTGAGCTGAAGCACATCCGTGTGGCGGGCAAGTAGTACTTTGTCGACTTTGAAATCCCGTTTGAAATCCCGACGCACTTGACGGTGACGGCCCTGTGGCGCTACATGTATGTATCACATGTACCAGCTGGACGCAGCTGGACGCCTTCACACAATCGTGGGCCGACCAGGACATTATCAATCAC

Full Affymetrix probeset data:

Annotations for 1631073_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720