FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631074_at:

>probe:Drosophila_2:1631074_at:531:729; Interrogation_Position=1042; Antisense; TTGGCTGCCTACAGTGACAGCTCAG
>probe:Drosophila_2:1631074_at:653:435; Interrogation_Position=1066; Antisense; GAGGATTCCAACTGACCAAGCATTT
>probe:Drosophila_2:1631074_at:627:129; Interrogation_Position=1091; Antisense; ACCTGATGACACACTTACAACTCGA
>probe:Drosophila_2:1631074_at:584:201; Interrogation_Position=559; Antisense; AACCGGCGTCAGCAGACAGTGGACT
>probe:Drosophila_2:1631074_at:320:83; Interrogation_Position=576; Antisense; AGTGGACTACAACACTCTGCTGCAG
>probe:Drosophila_2:1631074_at:528:621; Interrogation_Position=593; Antisense; TGCTGCAGCAGTACAACACGGTGGA
>probe:Drosophila_2:1631074_at:1:209; Interrogation_Position=702; Antisense; AAGCTCTCGTGTTGTCGCTGAGGAA
>probe:Drosophila_2:1631074_at:320:71; Interrogation_Position=743; Antisense; AGGATGAACCGTTGGACACACCGTC
>probe:Drosophila_2:1631074_at:160:47; Interrogation_Position=837; Antisense; ATCCGCAGCGCAGTCAATGGTTAAA
>probe:Drosophila_2:1631074_at:686:123; Interrogation_Position=887; Antisense; AGCCCAAGGCAACCGCAGTAGCAAA
>probe:Drosophila_2:1631074_at:35:539; Interrogation_Position=918; Antisense; GGTAGCCACTGGAACGACGCAAGTT
>probe:Drosophila_2:1631074_at:181:253; Interrogation_Position=937; Antisense; CAAGTTGAATCCAAACCAGCCGCAA
>probe:Drosophila_2:1631074_at:290:649; Interrogation_Position=970; Antisense; TCAGTTGTGTCTGCACCAGCGGAAA
>probe:Drosophila_2:1631074_at:557:171; Interrogation_Position=997; Antisense; AAAGCTACAAATCAGCCAGCTGCCG

Paste this into a BLAST search page for me
TTGGCTGCCTACAGTGACAGCTCAGGAGGATTCCAACTGACCAAGCATTTACCTGATGACACACTTACAACTCGAAACCGGCGTCAGCAGACAGTGGACTAGTGGACTACAACACTCTGCTGCAGTGCTGCAGCAGTACAACACGGTGGAAAGCTCTCGTGTTGTCGCTGAGGAAAGGATGAACCGTTGGACACACCGTCATCCGCAGCGCAGTCAATGGTTAAAAGCCCAAGGCAACCGCAGTAGCAAAGGTAGCCACTGGAACGACGCAAGTTCAAGTTGAATCCAAACCAGCCGCAATCAGTTGTGTCTGCACCAGCGGAAAAAAGCTACAAATCAGCCAGCTGCCG

Full Affymetrix probeset data:

Annotations for 1631074_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720