FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631076_at:

>probe:Drosophila_2:1631076_at:681:427; Interrogation_Position=1019; Antisense; GAGATTAGCTACATGACAGCCTCCC
>probe:Drosophila_2:1631076_at:675:5; Interrogation_Position=1076; Antisense; ATTGCGGACGTTACGTTCGCCCATT
>probe:Drosophila_2:1631076_at:554:629; Interrogation_Position=1100; Antisense; TCCATTCCCGTCCATAGCTATATAA
>probe:Drosophila_2:1631076_at:325:611; Interrogation_Position=1128; Antisense; TGAAGGCGTACGTGGTTTTCACCCA
>probe:Drosophila_2:1631076_at:15:619; Interrogation_Position=1247; Antisense; TGCAGCAAAGCAGTTCCGGAGATCC
>probe:Drosophila_2:1631076_at:377:551; Interrogation_Position=1264; Antisense; GGAGATCCTTCCCAGAAGCTATCAC
>probe:Drosophila_2:1631076_at:635:685; Interrogation_Position=1283; Antisense; TATCACGAGGCGCTGTGGTACCTAA
>probe:Drosophila_2:1631076_at:442:593; Interrogation_Position=1296; Antisense; TGTGGTACCTAACTGGTCGTCGCTA
>probe:Drosophila_2:1631076_at:297:503; Interrogation_Position=1314; Antisense; GTCGCTACTTCAATCGATTCCGTGA
>probe:Drosophila_2:1631076_at:174:401; Interrogation_Position=1352; Antisense; GACATGGACAATGGATCTGCCGTAG
>probe:Drosophila_2:1631076_at:61:57; Interrogation_Position=867; Antisense; ATGACGGACCTTCGCCGAGTGATAT
>probe:Drosophila_2:1631076_at:315:603; Interrogation_Position=886; Antisense; TGATATGACTACTCTACCACCGAAT
>probe:Drosophila_2:1631076_at:81:589; Interrogation_Position=917; Antisense; TGGATGTCCACGTGGCGCCGCAGAA
>probe:Drosophila_2:1631076_at:379:435; Interrogation_Position=993; Antisense; GAGGGTTCATCATCCGCAAGGCTAT

Paste this into a BLAST search page for me
GAGATTAGCTACATGACAGCCTCCCATTGCGGACGTTACGTTCGCCCATTTCCATTCCCGTCCATAGCTATATAATGAAGGCGTACGTGGTTTTCACCCATGCAGCAAAGCAGTTCCGGAGATCCGGAGATCCTTCCCAGAAGCTATCACTATCACGAGGCGCTGTGGTACCTAATGTGGTACCTAACTGGTCGTCGCTAGTCGCTACTTCAATCGATTCCGTGAGACATGGACAATGGATCTGCCGTAGATGACGGACCTTCGCCGAGTGATATTGATATGACTACTCTACCACCGAATTGGATGTCCACGTGGCGCCGCAGAAGAGGGTTCATCATCCGCAAGGCTAT

Full Affymetrix probeset data:

Annotations for 1631076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720