FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631077_at:

>probe:Drosophila_2:1631077_at:334:451; Interrogation_Position=117; Antisense; GATCGTCGTGTTCCTCAAGTTGGGA
>probe:Drosophila_2:1631077_at:116:251; Interrogation_Position=132; Antisense; CAAGTTGGGATTTTTTGCGCGTCGT
>probe:Drosophila_2:1631077_at:86:417; Interrogation_Position=159; Antisense; GAGCCGCGAGGAACCAGACTTCAGT
>probe:Drosophila_2:1631077_at:243:311; Interrogation_Position=213; Antisense; GCCACTGCGGAAGGACTTTACGGTT
>probe:Drosophila_2:1631077_at:261:381; Interrogation_Position=241; Antisense; GAACTTCGGGAATATGACGGCACAC
>probe:Drosophila_2:1631077_at:60:221; Interrogation_Position=28; Antisense; AAGGGCATGGAACACACCACCAGCT
>probe:Drosophila_2:1631077_at:332:577; Interrogation_Position=288; Antisense; GGCCATCCTTTTCAACATCTACGAT
>probe:Drosophila_2:1631077_at:434:59; Interrogation_Position=311; Antisense; ATGTCTCGCGATCCGTTCACTATTA
>probe:Drosophila_2:1631077_at:187:707; Interrogation_Position=350; Antisense; TTAATCCAAACTATGCCGGTCGGGA
>probe:Drosophila_2:1631077_at:128:59; Interrogation_Position=431; Antisense; ATGATTTGAGCGACCTCTCACGCAA
>probe:Drosophila_2:1631077_at:350:309; Interrogation_Position=44; Antisense; CCACCAGCTGGTACTGCAAACTTTA
>probe:Drosophila_2:1631077_at:417:701; Interrogation_Position=555; Antisense; TTTTGAGCTGCAGCAAGCGGATCCG
>probe:Drosophila_2:1631077_at:419:657; Interrogation_Position=78; Antisense; TAAGGAAACACCCATCGATGTCACC
>probe:Drosophila_2:1631077_at:470:443; Interrogation_Position=94; Antisense; GATGTCACCCTTTTGATCATGTCGA

Paste this into a BLAST search page for me
GATCGTCGTGTTCCTCAAGTTGGGACAAGTTGGGATTTTTTGCGCGTCGTGAGCCGCGAGGAACCAGACTTCAGTGCCACTGCGGAAGGACTTTACGGTTGAACTTCGGGAATATGACGGCACACAAGGGCATGGAACACACCACCAGCTGGCCATCCTTTTCAACATCTACGATATGTCTCGCGATCCGTTCACTATTATTAATCCAAACTATGCCGGTCGGGAATGATTTGAGCGACCTCTCACGCAACCACCAGCTGGTACTGCAAACTTTATTTTGAGCTGCAGCAAGCGGATCCGTAAGGAAACACCCATCGATGTCACCGATGTCACCCTTTTGATCATGTCGA

Full Affymetrix probeset data:

Annotations for 1631077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720