FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631078_at:

>probe:Drosophila_2:1631078_at:301:727; Interrogation_Position=1018; Antisense; TTGTATCCCGGAATGCGTCTTCAGT
>probe:Drosophila_2:1631078_at:288:645; Interrogation_Position=1035; Antisense; TCTTCAGTTGCTTCGTGCCAGGGCA
>probe:Drosophila_2:1631078_at:23:139; Interrogation_Position=1059; Antisense; ACGTTTCATGCCCAAGAAGCACTTG
>probe:Drosophila_2:1631078_at:492:209; Interrogation_Position=1075; Antisense; AAGCACTTGCAGGTGGCATTGCGCA
>probe:Drosophila_2:1631078_at:186:533; Interrogation_Position=1086; Antisense; GGTGGCATTGCGCAATTGCAGTTTT
>probe:Drosophila_2:1631078_at:468:91; Interrogation_Position=1105; Antisense; AGTTTTGGCGACTGGTTCGTGCTGA
>probe:Drosophila_2:1631078_at:636:123; Interrogation_Position=1150; Antisense; AGCCCCGAGCTATTCCGTAAGTTGC
>probe:Drosophila_2:1631078_at:561:487; Interrogation_Position=1185; Antisense; GTACGAAGCTCAGTCCTTGATCAAA
>probe:Drosophila_2:1631078_at:432:275; Interrogation_Position=1200; Antisense; CTTGATCAAAATACCGCCAGGAGCG
>probe:Drosophila_2:1631078_at:686:311; Interrogation_Position=1215; Antisense; GCCAGGAGCGGACAAGATCTAAGAT
>probe:Drosophila_2:1631078_at:14:507; Interrogation_Position=1419; Antisense; GTGCCATTTTCACTTGTTCAGTAAA
>probe:Drosophila_2:1631078_at:115:611; Interrogation_Position=1476; Antisense; TGACCATTTGAATCCTTAATTGGCT
>probe:Drosophila_2:1631078_at:530:29; Interrogation_Position=964; Antisense; ATACTAGTGGCTATGCTCATTTCCC
>probe:Drosophila_2:1631078_at:111:645; Interrogation_Position=980; Antisense; TCATTTCCCTCAAGTTTCTGTACCG

Paste this into a BLAST search page for me
TTGTATCCCGGAATGCGTCTTCAGTTCTTCAGTTGCTTCGTGCCAGGGCAACGTTTCATGCCCAAGAAGCACTTGAAGCACTTGCAGGTGGCATTGCGCAGGTGGCATTGCGCAATTGCAGTTTTAGTTTTGGCGACTGGTTCGTGCTGAAGCCCCGAGCTATTCCGTAAGTTGCGTACGAAGCTCAGTCCTTGATCAAACTTGATCAAAATACCGCCAGGAGCGGCCAGGAGCGGACAAGATCTAAGATGTGCCATTTTCACTTGTTCAGTAAATGACCATTTGAATCCTTAATTGGCTATACTAGTGGCTATGCTCATTTCCCTCATTTCCCTCAAGTTTCTGTACCG

Full Affymetrix probeset data:

Annotations for 1631078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720