FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631082_at:

>probe:Drosophila_2:1631082_at:440:293; Interrogation_Position=552; Antisense; CGTTAGCTGGCAGGTAAGTGAGCAT
>probe:Drosophila_2:1631082_at:663:219; Interrogation_Position=567; Antisense; AAGTGAGCATGGATCGATGTATCGC
>probe:Drosophila_2:1631082_at:291:115; Interrogation_Position=572; Antisense; AGCATGGATCGATGTATCGCGCCTT
>probe:Drosophila_2:1631082_at:429:587; Interrogation_Position=576; Antisense; TGGATCGATGTATCGCGCCTTGGGC
>probe:Drosophila_2:1631082_at:638:59; Interrogation_Position=583; Antisense; ATGTATCGCGCCTTGGGCGTGGTAT
>probe:Drosophila_2:1631082_at:490:593; Interrogation_Position=596; Antisense; TGGGCGTGGTATATACTGTAGCTTA
>probe:Drosophila_2:1631082_at:342:687; Interrogation_Position=607; Antisense; TATACTGTAGCTTAGATTCGAGGAG
>probe:Drosophila_2:1631082_at:170:341; Interrogation_Position=616; Antisense; GCTTAGATTCGAGGAGTGTAGTACT
>probe:Drosophila_2:1631082_at:664:467; Interrogation_Position=631; Antisense; GTGTAGTACTAGAATTAAAACGGCT
>probe:Drosophila_2:1631082_at:398:191; Interrogation_Position=649; Antisense; AACGGCTAACCGACTGAAATGGATC
>probe:Drosophila_2:1631082_at:249:539; Interrogation_Position=652; Antisense; GGCTAACCGACTGAAATGGATCACT
>probe:Drosophila_2:1631082_at:539:201; Interrogation_Position=656; Antisense; AACCGACTGAAATGGATCACTATTA
>probe:Drosophila_2:1631082_at:69:545; Interrogation_Position=669; Antisense; GGATCACTATTACAAACACCCATTA
>probe:Drosophila_2:1631082_at:473:663; Interrogation_Position=679; Antisense; TACAAACACCCATTAATCAACTTAC

Paste this into a BLAST search page for me
CGTTAGCTGGCAGGTAAGTGAGCATAAGTGAGCATGGATCGATGTATCGCAGCATGGATCGATGTATCGCGCCTTTGGATCGATGTATCGCGCCTTGGGCATGTATCGCGCCTTGGGCGTGGTATTGGGCGTGGTATATACTGTAGCTTATATACTGTAGCTTAGATTCGAGGAGGCTTAGATTCGAGGAGTGTAGTACTGTGTAGTACTAGAATTAAAACGGCTAACGGCTAACCGACTGAAATGGATCGGCTAACCGACTGAAATGGATCACTAACCGACTGAAATGGATCACTATTAGGATCACTATTACAAACACCCATTATACAAACACCCATTAATCAACTTAC

Full Affymetrix probeset data:

Annotations for 1631082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720