FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631084_at:

>probe:Drosophila_2:1631084_at:667:721; Interrogation_Position=385; Antisense; TTGCCATACAGTTCTTCCGCTTCTT
>probe:Drosophila_2:1631084_at:61:719; Interrogation_Position=399; Antisense; TTCCGCTTCTTATCAATCACGTGGT
>probe:Drosophila_2:1631084_at:632:237; Interrogation_Position=413; Antisense; AATCACGTGGTTTCGGTGCCTTTGC
>probe:Drosophila_2:1631084_at:415:291; Interrogation_Position=498; Antisense; CGTGTTGCCACCGAGCTATTTGGAA
>probe:Drosophila_2:1631084_at:638:679; Interrogation_Position=514; Antisense; TATTTGGAACCGCTGCGCAGCTACA
>probe:Drosophila_2:1631084_at:83:117; Interrogation_Position=569; Antisense; AGCATCTGAGCCAACAGCAGCTGCA
>probe:Drosophila_2:1631084_at:504:317; Interrogation_Position=606; Antisense; GCCTGGAACCCCAAAGCTCGAGGAT
>probe:Drosophila_2:1631084_at:559:267; Interrogation_Position=693; Antisense; CATGATCAGTGCCACCGGAACGGAC
>probe:Drosophila_2:1631084_at:111:197; Interrogation_Position=711; Antisense; AACGGACAGCGGCATCAGCAATTGC
>probe:Drosophila_2:1631084_at:260:649; Interrogation_Position=725; Antisense; TCAGCAATTGCAGCACGCGGGCGAG
>probe:Drosophila_2:1631084_at:648:399; Interrogation_Position=754; Antisense; GACAGTAGTCAGAGCACGCCCGTTT
>probe:Drosophila_2:1631084_at:545:419; Interrogation_Position=765; Antisense; GAGCACGCCCGTTTACAGTGGAGAA
>probe:Drosophila_2:1631084_at:224:473; Interrogation_Position=796; Antisense; GTTAACATGTCTGTGGAGTCCGCCT
>probe:Drosophila_2:1631084_at:328:157; Interrogation_Position=911; Antisense; ACACTCCGCTCGATATTACCGGTAA

Paste this into a BLAST search page for me
TTGCCATACAGTTCTTCCGCTTCTTTTCCGCTTCTTATCAATCACGTGGTAATCACGTGGTTTCGGTGCCTTTGCCGTGTTGCCACCGAGCTATTTGGAATATTTGGAACCGCTGCGCAGCTACAAGCATCTGAGCCAACAGCAGCTGCAGCCTGGAACCCCAAAGCTCGAGGATCATGATCAGTGCCACCGGAACGGACAACGGACAGCGGCATCAGCAATTGCTCAGCAATTGCAGCACGCGGGCGAGGACAGTAGTCAGAGCACGCCCGTTTGAGCACGCCCGTTTACAGTGGAGAAGTTAACATGTCTGTGGAGTCCGCCTACACTCCGCTCGATATTACCGGTAA

Full Affymetrix probeset data:

Annotations for 1631084_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720