FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631088_at:

>probe:Drosophila_2:1631088_at:94:541; Interrogation_Position=1001; Antisense; GGTTACAACTGCTGCTATATGCGTT
>probe:Drosophila_2:1631088_at:561:507; Interrogation_Position=1043; Antisense; GTGCGCATGCGCAGACGACATTAAA
>probe:Drosophila_2:1631088_at:16:93; Interrogation_Position=493; Antisense; AGTTCAAGCCTTTCGACTGGACATT
>probe:Drosophila_2:1631088_at:655:385; Interrogation_Position=608; Antisense; GAACATCATCTTCTACCACGATTTA
>probe:Drosophila_2:1631088_at:140:445; Interrogation_Position=645; Antisense; GATGAGCTGCACGACCACGGAATAT
>probe:Drosophila_2:1631088_at:555:587; Interrogation_Position=739; Antisense; TGGACCACGTGCTAATCCGGATGCA
>probe:Drosophila_2:1631088_at:419:101; Interrogation_Position=809; Antisense; AGAGTACATCCATCGGGAGGCGCCT
>probe:Drosophila_2:1631088_at:8:71; Interrogation_Position=826; Antisense; AGGCGCCTTGCACTGAGCTTCAAAA
>probe:Drosophila_2:1631088_at:121:711; Interrogation_Position=844; Antisense; TTCAAAACTGTGTGGCCTTCTGGAC
>probe:Drosophila_2:1631088_at:133:365; Interrogation_Position=888; Antisense; GAATTTGTGCCCGTGAAGTCCAAGC
>probe:Drosophila_2:1631088_at:508:655; Interrogation_Position=932; Antisense; TAAGTAGTCCCGATGTCCGATGCTA
>probe:Drosophila_2:1631088_at:281:445; Interrogation_Position=950; Antisense; GATGCTAGATGCCAGATCCCAGATC
>probe:Drosophila_2:1631088_at:704:449; Interrogation_Position=971; Antisense; GATCTCTAGGTTTATGTCAGTCGTC
>probe:Drosophila_2:1631088_at:76:497; Interrogation_Position=986; Antisense; GTCAGTCGTCGCATTGGTTACAACT

Paste this into a BLAST search page for me
GGTTACAACTGCTGCTATATGCGTTGTGCGCATGCGCAGACGACATTAAAAGTTCAAGCCTTTCGACTGGACATTGAACATCATCTTCTACCACGATTTAGATGAGCTGCACGACCACGGAATATTGGACCACGTGCTAATCCGGATGCAAGAGTACATCCATCGGGAGGCGCCTAGGCGCCTTGCACTGAGCTTCAAAATTCAAAACTGTGTGGCCTTCTGGACGAATTTGTGCCCGTGAAGTCCAAGCTAAGTAGTCCCGATGTCCGATGCTAGATGCTAGATGCCAGATCCCAGATCGATCTCTAGGTTTATGTCAGTCGTCGTCAGTCGTCGCATTGGTTACAACT

Full Affymetrix probeset data:

Annotations for 1631088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720