Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631092_at:

>probe:Drosophila_2:1631092_at:60:123; Interrogation_Position=1568; Antisense; AGCGATGTGTTTGTACCAGTTGGAA
>probe:Drosophila_2:1631092_at:214:75; Interrogation_Position=1598; Antisense; AGGACTTCACCGGTGGCGCATACAC
>probe:Drosophila_2:1631092_at:396:279; Interrogation_Position=1623; Antisense; CTCAATACCGGTGGGCGCAACTCAG
>probe:Drosophila_2:1631092_at:147:315; Interrogation_Position=1705; Antisense; GCCATAGTCTTTGCCGGAGAGCACA
>probe:Drosophila_2:1631092_at:482:5; Interrogation_Position=1733; Antisense; ATTCCAGTTTCTACTCTACCGTACA
>probe:Drosophila_2:1631092_at:366:659; Interrogation_Position=1754; Antisense; TACACGGCGCCTATTTGAGCGGACG
>probe:Drosophila_2:1631092_at:627:395; Interrogation_Position=1819; Antisense; GAAATCATCATGGAGTCGGACGGCA
>probe:Drosophila_2:1631092_at:659:349; Interrogation_Position=1841; Antisense; GCAGTGATCTGAGCGCCTGGATACA
>probe:Drosophila_2:1631092_at:444:525; Interrogation_Position=1866; Antisense; GGGCATTGCCCTGGACTGAGTCTAA
>probe:Drosophila_2:1631092_at:105:119; Interrogation_Position=1890; Antisense; AGCTAATCAACGACCACTCATCGAT
>probe:Drosophila_2:1631092_at:330:493; Interrogation_Position=1993; Antisense; GTAATTTATTTTGCTAGCGTCGTAA
>probe:Drosophila_2:1631092_at:471:193; Interrogation_Position=2026; Antisense; AACTCATTTTTGTACATCCCTTGTG
>probe:Drosophila_2:1631092_at:146:271; Interrogation_Position=2040; Antisense; CATCCCTTGTGAGCATTTGTTTTAT
>probe:Drosophila_2:1631092_at:592:725; Interrogation_Position=2094; Antisense; TTGGAACCCGCTTGTACATTACTAT

Paste this into a BLAST search page for me
AGCGATGTGTTTGTACCAGTTGGAAAGGACTTCACCGGTGGCGCATACACCTCAATACCGGTGGGCGCAACTCAGGCCATAGTCTTTGCCGGAGAGCACAATTCCAGTTTCTACTCTACCGTACATACACGGCGCCTATTTGAGCGGACGGAAATCATCATGGAGTCGGACGGCAGCAGTGATCTGAGCGCCTGGATACAGGGCATTGCCCTGGACTGAGTCTAAAGCTAATCAACGACCACTCATCGATGTAATTTATTTTGCTAGCGTCGTAAAACTCATTTTTGTACATCCCTTGTGCATCCCTTGTGAGCATTTGTTTTATTTGGAACCCGCTTGTACATTACTAT

Full Affymetrix probeset data:

Annotations for 1631092_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime