FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631093_at:

>probe:Drosophila_2:1631093_at:7:667; Interrogation_Position=535; Antisense; TACTTATGTTCCAACGCGAGTTCGC
>probe:Drosophila_2:1631093_at:285:719; Interrogation_Position=555; Antisense; TTCGCAGAACGATTGGTGGCCAAAC
>probe:Drosophila_2:1631093_at:599:533; Interrogation_Position=582; Antisense; GGTGATAAGCTCTACTGTCGTCTGA
>probe:Drosophila_2:1631093_at:574:571; Interrogation_Position=597; Antisense; TGTCGTCTGAGTATCAACACCCAAC
>probe:Drosophila_2:1631093_at:81:583; Interrogation_Position=625; Antisense; TGGCCCGGGTGGACATGCTCATGAA
>probe:Drosophila_2:1631093_at:421:347; Interrogation_Position=655; Antisense; GCAAGAACAACTTTAGGCCGCCACC
>probe:Drosophila_2:1631093_at:279:1; Interrogation_Position=735; Antisense; AACTTCACCGAATGGGACGGACTCA
>probe:Drosophila_2:1631093_at:690:481; Interrogation_Position=763; Antisense; GTATTGCCTTCCTGCGCAAGAACAA
>probe:Drosophila_2:1631093_at:153:177; Interrogation_Position=788; Antisense; AACGCTGGCGGCTACCTTTAAGGTG
>probe:Drosophila_2:1631093_at:688:79; Interrogation_Position=808; Antisense; AGGTGACGTCCGTTTTGGAGATGTT
>probe:Drosophila_2:1631093_at:69:117; Interrogation_Position=847; Antisense; AGCTATACCGCTCACTCAGGAATGA
>probe:Drosophila_2:1631093_at:686:563; Interrogation_Position=865; Antisense; GGAATGAGCCGATTGAAGACGACTT
>probe:Drosophila_2:1631093_at:427:557; Interrogation_Position=959; Antisense; GGACATCGACGACTTTATGCGGCTC
>probe:Drosophila_2:1631093_at:473:713; Interrogation_Position=998; Antisense; TTCAGCGGGCATTCACTTCAATTAG

Paste this into a BLAST search page for me
TACTTATGTTCCAACGCGAGTTCGCTTCGCAGAACGATTGGTGGCCAAACGGTGATAAGCTCTACTGTCGTCTGATGTCGTCTGAGTATCAACACCCAACTGGCCCGGGTGGACATGCTCATGAAGCAAGAACAACTTTAGGCCGCCACCAACTTCACCGAATGGGACGGACTCAGTATTGCCTTCCTGCGCAAGAACAAAACGCTGGCGGCTACCTTTAAGGTGAGGTGACGTCCGTTTTGGAGATGTTAGCTATACCGCTCACTCAGGAATGAGGAATGAGCCGATTGAAGACGACTTGGACATCGACGACTTTATGCGGCTCTTCAGCGGGCATTCACTTCAATTAG

Full Affymetrix probeset data:

Annotations for 1631093_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720