Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631096_a_at:

>probe:Drosophila_2:1631096_a_at:643:689; Interrogation_Position=107; Antisense; TTTGGCCCCAAACAATGGAGGCCCT
>probe:Drosophila_2:1631096_a_at:706:63; Interrogation_Position=121; Antisense; ATGGAGGCCCTAGTGAATTATAGTA
>probe:Drosophila_2:1631096_a_at:100:243; Interrogation_Position=136; Antisense; AATTATAGTAGTGAGGACGACCAGG
>probe:Drosophila_2:1631096_a_at:319:137; Interrogation_Position=152; Antisense; ACGACCAGGAGGATGCTGGCTTTCA
>probe:Drosophila_2:1631096_a_at:547:583; Interrogation_Position=168; Antisense; TGGCTTTCAGATACGGGCACCACAA
>probe:Drosophila_2:1631096_a_at:265:695; Interrogation_Position=213; Antisense; TTTGCCGCATGCTAAATCCCCGAAA
>probe:Drosophila_2:1631096_a_at:175:257; Interrogation_Position=23; Antisense; CACTACTTTCTTTTTTAGCAATTGA
>probe:Drosophila_2:1631096_a_at:568:87; Interrogation_Position=295; Antisense; AGTCCGCGCGGCAAGGAACGAGAAA
>probe:Drosophila_2:1631096_a_at:100:377; Interrogation_Position=342; Antisense; GAAGACAAAGCCGATGTCGCAGCAG
>probe:Drosophila_2:1631096_a_at:662:61; Interrogation_Position=355; Antisense; ATGTCGCAGCAGCAGAGTCATAGGA
>probe:Drosophila_2:1631096_a_at:374:351; Interrogation_Position=366; Antisense; GCAGAGTCATAGGAGCAGCAGCAGA
>probe:Drosophila_2:1631096_a_at:16:353; Interrogation_Position=380; Antisense; GCAGCAGCAGAGGACGCATTGATGA
>probe:Drosophila_2:1631096_a_at:357:701; Interrogation_Position=58; Antisense; TTTTGGACGCACCTGCGTGCTTCAG
>probe:Drosophila_2:1631096_a_at:233:505; Interrogation_Position=74; Antisense; GTGCTTCAGCCACATTTTTGGCCTA

Paste this into a BLAST search page for me
TTTGGCCCCAAACAATGGAGGCCCTATGGAGGCCCTAGTGAATTATAGTAAATTATAGTAGTGAGGACGACCAGGACGACCAGGAGGATGCTGGCTTTCATGGCTTTCAGATACGGGCACCACAATTTGCCGCATGCTAAATCCCCGAAACACTACTTTCTTTTTTAGCAATTGAAGTCCGCGCGGCAAGGAACGAGAAAGAAGACAAAGCCGATGTCGCAGCAGATGTCGCAGCAGCAGAGTCATAGGAGCAGAGTCATAGGAGCAGCAGCAGAGCAGCAGCAGAGGACGCATTGATGATTTTGGACGCACCTGCGTGCTTCAGGTGCTTCAGCCACATTTTTGGCCTA

Full Affymetrix probeset data:

Annotations for 1631096_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime