FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631097_at:

>probe:Drosophila_2:1631097_at:644:463; Interrogation_Position=1007; Antisense; GATTCGCCAGTGATTCGCAGTCCAG
>probe:Drosophila_2:1631097_at:450:153; Interrogation_Position=1077; Antisense; ACAGGATTCCCTGGTGTCCACAGAT
>probe:Drosophila_2:1631097_at:175:331; Interrogation_Position=543; Antisense; GCGGACCATCTTTGGCGGACAATCT
>probe:Drosophila_2:1631097_at:69:559; Interrogation_Position=559; Antisense; GGACAATCTGGAATCGGCTCGGGTT
>probe:Drosophila_2:1631097_at:225:697; Interrogation_Position=612; Antisense; TTTCACATCGCCTTCAAGTGCGGAT
>probe:Drosophila_2:1631097_at:245:41; Interrogation_Position=635; Antisense; ATCTGGAGATGTTGGCACCTCTGGG
>probe:Drosophila_2:1631097_at:371:129; Interrogation_Position=651; Antisense; ACCTCTGGGCTGTGATCAGTACTAC
>probe:Drosophila_2:1631097_at:351:667; Interrogation_Position=673; Antisense; TACAGGACCACCACTGGCGGAATAG
>probe:Drosophila_2:1631097_at:611:723; Interrogation_Position=710; Antisense; TTGCAGGTGGCGTCTATATGCCCAA
>probe:Drosophila_2:1631097_at:650:215; Interrogation_Position=787; Antisense; AAGATCACGCACTTTGAGCTCTCGA
>probe:Drosophila_2:1631097_at:278:681; Interrogation_Position=841; Antisense; TATGACACCGATTGCCGCAGTACAG
>probe:Drosophila_2:1631097_at:39:305; Interrogation_Position=874; Antisense; CCGTTGCGCGTATCTGACTATGTGA
>probe:Drosophila_2:1631097_at:596:403; Interrogation_Position=889; Antisense; GACTATGTGAGCATTCCCGATGCAT
>probe:Drosophila_2:1631097_at:514:53; Interrogation_Position=908; Antisense; ATGCATACATGGTCGGCAGGCCAGA

Paste this into a BLAST search page for me
GATTCGCCAGTGATTCGCAGTCCAGACAGGATTCCCTGGTGTCCACAGATGCGGACCATCTTTGGCGGACAATCTGGACAATCTGGAATCGGCTCGGGTTTTTCACATCGCCTTCAAGTGCGGATATCTGGAGATGTTGGCACCTCTGGGACCTCTGGGCTGTGATCAGTACTACTACAGGACCACCACTGGCGGAATAGTTGCAGGTGGCGTCTATATGCCCAAAAGATCACGCACTTTGAGCTCTCGATATGACACCGATTGCCGCAGTACAGCCGTTGCGCGTATCTGACTATGTGAGACTATGTGAGCATTCCCGATGCATATGCATACATGGTCGGCAGGCCAGA

Full Affymetrix probeset data:

Annotations for 1631097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720