FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631098_at:

>probe:Drosophila_2:1631098_at:442:341; Interrogation_Position=1029; Antisense; GCTTTGTATTGCTCAGACATGCGGT
>probe:Drosophila_2:1631098_at:40:591; Interrogation_Position=1053; Antisense; TGGTAGCTACCATCATGTGGCCCAA
>probe:Drosophila_2:1631098_at:428:415; Interrogation_Position=1125; Antisense; GAGCCTTTTTCATGCCATTTGCAGA
>probe:Drosophila_2:1631098_at:576:327; Interrogation_Position=1159; Antisense; GCGTACATGCACACATTTGGCTCAT
>probe:Drosophila_2:1631098_at:411:691; Interrogation_Position=1174; Antisense; TTTGGCTCATTCACAAGGGCGCAGA
>probe:Drosophila_2:1631098_at:608:33; Interrogation_Position=1282; Antisense; ATCAAAAGTCATTTCGGCCGCACAT
>probe:Drosophila_2:1631098_at:354:717; Interrogation_Position=1294; Antisense; TTCGGCCGCACATTTGATTGTTTAC
>probe:Drosophila_2:1631098_at:328:465; Interrogation_Position=1309; Antisense; GATTGTTTACATTGTCCCTGAACTT
>probe:Drosophila_2:1631098_at:538:557; Interrogation_Position=791; Antisense; GGAAATTGCCTCACTTGTCCAGCTA
>probe:Drosophila_2:1631098_at:614:387; Interrogation_Position=822; Antisense; GAAAACAGTTTTGCTTCATCGCCTC
>probe:Drosophila_2:1631098_at:491:645; Interrogation_Position=837; Antisense; TCATCGCCTCGAAAGTGCTGACTGG
>probe:Drosophila_2:1631098_at:572:129; Interrogation_Position=869; Antisense; ACCTGGGCACCCTATTGGTTGAGAT
>probe:Drosophila_2:1631098_at:125:21; Interrogation_Position=902; Antisense; ATTTGGTGGATCATCTACGCGCTCG
>probe:Drosophila_2:1631098_at:290:671; Interrogation_Position=917; Antisense; TACGCGCTCGTAGACTGGAGTTCTT

Paste this into a BLAST search page for me
GCTTTGTATTGCTCAGACATGCGGTTGGTAGCTACCATCATGTGGCCCAAGAGCCTTTTTCATGCCATTTGCAGAGCGTACATGCACACATTTGGCTCATTTTGGCTCATTCACAAGGGCGCAGAATCAAAAGTCATTTCGGCCGCACATTTCGGCCGCACATTTGATTGTTTACGATTGTTTACATTGTCCCTGAACTTGGAAATTGCCTCACTTGTCCAGCTAGAAAACAGTTTTGCTTCATCGCCTCTCATCGCCTCGAAAGTGCTGACTGGACCTGGGCACCCTATTGGTTGAGATATTTGGTGGATCATCTACGCGCTCGTACGCGCTCGTAGACTGGAGTTCTT

Full Affymetrix probeset data:

Annotations for 1631098_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720