FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631099_at:

>probe:Drosophila_2:1631099_at:361:197; Interrogation_Position=1327; Antisense; AACGTGTTTCGATGCGACTGTCTTG
>probe:Drosophila_2:1631099_at:631:439; Interrogation_Position=1378; Antisense; GATGGCTGCATCAGTATAGCGGTTA
>probe:Drosophila_2:1631099_at:93:27; Interrogation_Position=1393; Antisense; ATAGCGGTTATTCATCACCTGGCCA
>probe:Drosophila_2:1631099_at:538:3; Interrogation_Position=1431; Antisense; ATTGGCCGCCTTGCAGGAGATGGCA
>probe:Drosophila_2:1631099_at:151:413; Interrogation_Position=1466; Antisense; GACCTGGAGGACGTGCTTTGGTTTA
>probe:Drosophila_2:1631099_at:499:137; Interrogation_Position=1490; Antisense; ACGTTTGGGCCAAGGATCAGCGAAA
>probe:Drosophila_2:1631099_at:487:225; Interrogation_Position=1561; Antisense; AAGGAGCGTACCACTGAGCAGCAGC
>probe:Drosophila_2:1631099_at:569:235; Interrogation_Position=1627; Antisense; AATAATAACCCACTTCCTGTTCACA
>probe:Drosophila_2:1631099_at:302:237; Interrogation_Position=1654; Antisense; AATCGCACAGAGTTCCAGCAGCAAG
>probe:Drosophila_2:1631099_at:421:215; Interrogation_Position=1676; Antisense; AAGATGTTCTGGTGCCGTGGAAGAC
>probe:Drosophila_2:1631099_at:350:103; Interrogation_Position=1715; Antisense; AGACCACTTATCTGCGATACTACCA
>probe:Drosophila_2:1631099_at:404:387; Interrogation_Position=1762; Antisense; GAAAACCTTGTGTCCCAAGTGCATG
>probe:Drosophila_2:1631099_at:248:183; Interrogation_Position=1801; Antisense; AAAAGCTACTACGACCAGGGCAATC
>probe:Drosophila_2:1631099_at:446:81; Interrogation_Position=1817; Antisense; AGGGCAATCATTGCGCGATTTTTGA

Paste this into a BLAST search page for me
AACGTGTTTCGATGCGACTGTCTTGGATGGCTGCATCAGTATAGCGGTTAATAGCGGTTATTCATCACCTGGCCAATTGGCCGCCTTGCAGGAGATGGCAGACCTGGAGGACGTGCTTTGGTTTAACGTTTGGGCCAAGGATCAGCGAAAAAGGAGCGTACCACTGAGCAGCAGCAATAATAACCCACTTCCTGTTCACAAATCGCACAGAGTTCCAGCAGCAAGAAGATGTTCTGGTGCCGTGGAAGACAGACCACTTATCTGCGATACTACCAGAAAACCTTGTGTCCCAAGTGCATGAAAAGCTACTACGACCAGGGCAATCAGGGCAATCATTGCGCGATTTTTGA

Full Affymetrix probeset data:

Annotations for 1631099_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720