Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631100_at:

>probe:Drosophila_2:1631100_at:269:273; Interrogation_Position=2396; Antisense; CTTTACAGTGTTTAGATATCCCGCA
>probe:Drosophila_2:1631100_at:359:457; Interrogation_Position=2410; Antisense; GATATCCCGCAACTAAATGTGTCAT
>probe:Drosophila_2:1631100_at:138:729; Interrogation_Position=2434; Antisense; TTGGAACATGACCATTTGCCTCTGT
>probe:Drosophila_2:1631100_at:607:693; Interrogation_Position=2448; Antisense; TTTGCCTCTGTGATTTCGTCTTAAT
>probe:Drosophila_2:1631100_at:549:595; Interrogation_Position=2477; Antisense; TGTGATTACAAGTCCCATTGCTGAT
>probe:Drosophila_2:1631100_at:486:503; Interrogation_Position=2488; Antisense; GTCCCATTGCTGATAATTGTTTCGC
>probe:Drosophila_2:1631100_at:100:369; Interrogation_Position=2538; Antisense; GAATGCTGGTCGTGAGCCGTGTACA
>probe:Drosophila_2:1631100_at:383:499; Interrogation_Position=2546; Antisense; GTCGTGAGCCGTGTACAGTATTATA
>probe:Drosophila_2:1631100_at:393:539; Interrogation_Position=2576; Antisense; GGTATCTTCAAATTGCGATCCTTAA
>probe:Drosophila_2:1631100_at:178:313; Interrogation_Position=2590; Antisense; GCGATCCTTAAAGCACGAAGTCCAA
>probe:Drosophila_2:1631100_at:405:237; Interrogation_Position=2626; Antisense; AATCGATTCGTTAATGACCTTATCA
>probe:Drosophila_2:1631100_at:210:647; Interrogation_Position=2648; Antisense; TCAAACTCAAACCAAAACTCACCAA
>probe:Drosophila_2:1631100_at:215:663; Interrogation_Position=2792; Antisense; TAAATCCTACACAAGCACACAGCTG
>probe:Drosophila_2:1631100_at:367:177; Interrogation_Position=2914; Antisense; AAACATTTCGAGTCATTAAGCAAAC

Paste this into a BLAST search page for me
CTTTACAGTGTTTAGATATCCCGCAGATATCCCGCAACTAAATGTGTCATTTGGAACATGACCATTTGCCTCTGTTTTGCCTCTGTGATTTCGTCTTAATTGTGATTACAAGTCCCATTGCTGATGTCCCATTGCTGATAATTGTTTCGCGAATGCTGGTCGTGAGCCGTGTACAGTCGTGAGCCGTGTACAGTATTATAGGTATCTTCAAATTGCGATCCTTAAGCGATCCTTAAAGCACGAAGTCCAAAATCGATTCGTTAATGACCTTATCATCAAACTCAAACCAAAACTCACCAATAAATCCTACACAAGCACACAGCTGAAACATTTCGAGTCATTAAGCAAAC

Full Affymetrix probeset data:

Annotations for 1631100_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime