FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631101_at:

>probe:Drosophila_2:1631101_at:60:71; Interrogation_Position=239; Antisense; AGGCCATGGACAATGGTCTCTTCAC
>probe:Drosophila_2:1631101_at:6:499; Interrogation_Position=254; Antisense; GTCTCTTCACATTGGGAGCACCACA
>probe:Drosophila_2:1631101_at:331:421; Interrogation_Position=269; Antisense; GAGCACCACACAACGCTGGCGATGG
>probe:Drosophila_2:1631101_at:177:435; Interrogation_Position=304; Antisense; GAGGAGATTTTCACGGCTTTTCCCA
>probe:Drosophila_2:1631101_at:38:343; Interrogation_Position=319; Antisense; GCTTTTCCCATCAACGACCGAAAGG
>probe:Drosophila_2:1631101_at:597:499; Interrogation_Position=354; Antisense; GTCTGGCTATGGCAAGTACTTGAAA
>probe:Drosophila_2:1631101_at:92:199; Interrogation_Position=458; Antisense; AACGAATGGCTCTTCTATCCGAAAC
>probe:Drosophila_2:1631101_at:305:391; Interrogation_Position=478; Antisense; GAAACCGGACACTTTATGTCGATCG
>probe:Drosophila_2:1631101_at:435:699; Interrogation_Position=491; Antisense; TTATGTCGATCGATCCCCAAGACGA
>probe:Drosophila_2:1631101_at:437:137; Interrogation_Position=512; Antisense; ACGACGCCTGCGTGGCATTGCGAAA
>probe:Drosophila_2:1631101_at:616:63; Interrogation_Position=587; Antisense; ATGTGGTCATCGATACGGAGCCCAA
>probe:Drosophila_2:1631101_at:192:115; Interrogation_Position=719; Antisense; AGCAGGCAAAAGCTCAGGGATCTTT
>probe:Drosophila_2:1631101_at:260:529; Interrogation_Position=735; Antisense; GGGATCTTTGCATGAAACTCTTCTG
>probe:Drosophila_2:1631101_at:107:391; Interrogation_Position=748; Antisense; GAAACTCTTCTGGATAGACGCAGTA

Paste this into a BLAST search page for me
AGGCCATGGACAATGGTCTCTTCACGTCTCTTCACATTGGGAGCACCACAGAGCACCACACAACGCTGGCGATGGGAGGAGATTTTCACGGCTTTTCCCAGCTTTTCCCATCAACGACCGAAAGGGTCTGGCTATGGCAAGTACTTGAAAAACGAATGGCTCTTCTATCCGAAACGAAACCGGACACTTTATGTCGATCGTTATGTCGATCGATCCCCAAGACGAACGACGCCTGCGTGGCATTGCGAAAATGTGGTCATCGATACGGAGCCCAAAGCAGGCAAAAGCTCAGGGATCTTTGGGATCTTTGCATGAAACTCTTCTGGAAACTCTTCTGGATAGACGCAGTA

Full Affymetrix probeset data:

Annotations for 1631101_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720