FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631103_at:

>probe:Drosophila_2:1631103_at:636:233; Interrogation_Position=116; Antisense; AATGCGGTGTGGCTACCAAGCGAAC
>probe:Drosophila_2:1631103_at:203:469; Interrogation_Position=151; Antisense; GTTGCCGCTGAATCCGTGCACAGGA
>probe:Drosophila_2:1631103_at:266:643; Interrogation_Position=211; Antisense; TCTGCGTCGCTAATGGGATCCACAA
>probe:Drosophila_2:1631103_at:262:183; Interrogation_Position=235; Antisense; AAAACCCACGACGTCCATGAAGTGC
>probe:Drosophila_2:1631103_at:336:723; Interrogation_Position=282; Antisense; TTGCAAACGGAGTCCACCATGTGCT
>probe:Drosophila_2:1631103_at:65:349; Interrogation_Position=316; Antisense; GCATGTGCTGTCCACCAGATGAAGG
>probe:Drosophila_2:1631103_at:265:607; Interrogation_Position=363; Antisense; TGATGATGCTCTGCCAATTCTGTAC
>probe:Drosophila_2:1631103_at:410:299; Interrogation_Position=427; Antisense; CGCTGCCTGCTTAATTTCATTCATA
>probe:Drosophila_2:1631103_at:107:663; Interrogation_Position=450; Antisense; TAAACAGCTGCATTACGACCTCATG
>probe:Drosophila_2:1631103_at:136:137; Interrogation_Position=464; Antisense; ACGACCTCATGGTGCTTCATTGGGA
>probe:Drosophila_2:1631103_at:345:1; Interrogation_Position=514; Antisense; TCCCGACCCTTGAGTTCGAAGTCAA
>probe:Drosophila_2:1631103_at:729:237; Interrogation_Position=557; Antisense; CCACAACGGTGTGTTTCTACTTGGT
>probe:Drosophila_2:1631103_at:632:667; Interrogation_Position=574; Antisense; TACTTGGTGGTCTTGGCCATTCTCA
>probe:Drosophila_2:1631103_at:581:47; Interrogation_Position=634; Antisense; ATCCTGCTTGCGTGCCTGTTGAAGT

Paste this into a BLAST search page for me
AATGCGGTGTGGCTACCAAGCGAACGTTGCCGCTGAATCCGTGCACAGGATCTGCGTCGCTAATGGGATCCACAAAAAACCCACGACGTCCATGAAGTGCTTGCAAACGGAGTCCACCATGTGCTGCATGTGCTGTCCACCAGATGAAGGTGATGATGCTCTGCCAATTCTGTACCGCTGCCTGCTTAATTTCATTCATATAAACAGCTGCATTACGACCTCATGACGACCTCATGGTGCTTCATTGGGATCCCGACCCTTGAGTTCGAAGTCAACCACAACGGTGTGTTTCTACTTGGTTACTTGGTGGTCTTGGCCATTCTCAATCCTGCTTGCGTGCCTGTTGAAGT

Full Affymetrix probeset data:

Annotations for 1631103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720