Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631105_at:

>probe:Drosophila_2:1631105_at:388:221; Interrogation_Position=2187; Antisense; AAGTGTTGGCCATTCTGTTGACAAA
>probe:Drosophila_2:1631105_at:94:483; Interrogation_Position=2221; Antisense; GTATATTTACTCCTCAAACGATCCC
>probe:Drosophila_2:1631105_at:260:651; Interrogation_Position=2234; Antisense; TCAAACGATCCCCAAACAGTATAAT
>probe:Drosophila_2:1631105_at:293:605; Interrogation_Position=2267; Antisense; TGATCGTACGTCTATCTTAAACAGA
>probe:Drosophila_2:1631105_at:661:265; Interrogation_Position=2288; Antisense; CAGATGTTTGTGTACCCTTGCAGAT
>probe:Drosophila_2:1631105_at:363:217; Interrogation_Position=2351; Antisense; AAGTTCGTGTGATTGTTGACCATGC
>probe:Drosophila_2:1631105_at:569:603; Interrogation_Position=2364; Antisense; TGTTGACCATGCTGTGAGTTCGAAA
>probe:Drosophila_2:1631105_at:513:179; Interrogation_Position=2394; Antisense; AAAATCACCCACACTTGAAACGAAT
>probe:Drosophila_2:1631105_at:551:389; Interrogation_Position=2410; Antisense; GAAACGAATTTTGTCGAATCCAACT
>probe:Drosophila_2:1631105_at:590:367; Interrogation_Position=2425; Antisense; GAATCCAACTTACCTGCATCGAAAT
>probe:Drosophila_2:1631105_at:416:691; Interrogation_Position=2454; Antisense; TTTGATTTTTCCCTCCTTGTGTCAG
>probe:Drosophila_2:1631105_at:44:65; Interrogation_Position=2493; Antisense; ATGGGAAACCGTTGAAGCAGCACAA
>probe:Drosophila_2:1631105_at:59:603; Interrogation_Position=2656; Antisense; TGTTGTTAGTTAAGCGTAGCCTGAA
>probe:Drosophila_2:1631105_at:555:485; Interrogation_Position=2671; Antisense; GTAGCCTGAACGTCACACTTTGTAC

Paste this into a BLAST search page for me
AAGTGTTGGCCATTCTGTTGACAAAGTATATTTACTCCTCAAACGATCCCTCAAACGATCCCCAAACAGTATAATTGATCGTACGTCTATCTTAAACAGACAGATGTTTGTGTACCCTTGCAGATAAGTTCGTGTGATTGTTGACCATGCTGTTGACCATGCTGTGAGTTCGAAAAAAATCACCCACACTTGAAACGAATGAAACGAATTTTGTCGAATCCAACTGAATCCAACTTACCTGCATCGAAATTTTGATTTTTCCCTCCTTGTGTCAGATGGGAAACCGTTGAAGCAGCACAATGTTGTTAGTTAAGCGTAGCCTGAAGTAGCCTGAACGTCACACTTTGTAC

Full Affymetrix probeset data:

Annotations for 1631105_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime