Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631109_at:

>probe:Drosophila_2:1631109_at:563:337; Interrogation_Position=4000; Antisense; GCTCACCGCATCTCAAGGTCGTAGA
>probe:Drosophila_2:1631109_at:535:475; Interrogation_Position=4063; Antisense; GTTACTGTGATCTCGCTGCTCAAAA
>probe:Drosophila_2:1631109_at:326:175; Interrogation_Position=4085; Antisense; AAACGAGTTGTACGATGCCCGGCTT
>probe:Drosophila_2:1631109_at:83:617; Interrogation_Position=4120; Antisense; TGCACTGCATCTCTTTGGTACTGAA
>probe:Drosophila_2:1631109_at:621:203; Interrogation_Position=4143; Antisense; AAGCCACTGCCCCTGGATACTGATA
>probe:Drosophila_2:1631109_at:421:455; Interrogation_Position=4158; Antisense; GATACTGATATCTCCGCCTTCGTAG
>probe:Drosophila_2:1631109_at:144:567; Interrogation_Position=4205; Antisense; GGCAGTGCCACGATCCGGAGTTCAA
>probe:Drosophila_2:1631109_at:346:315; Interrogation_Position=4249; Antisense; GCCTACGTCTGCAGAGATTCGGATT
>probe:Drosophila_2:1631109_at:68:91; Interrogation_Position=4276; Antisense; AGTACACTCTGGATGCCCTGAAGGA
>probe:Drosophila_2:1631109_at:315:605; Interrogation_Position=4294; Antisense; TGAAGGACTACAGGCCCAACTACGA
>probe:Drosophila_2:1631109_at:251:659; Interrogation_Position=4330; Antisense; TAACGCGGGCCATGATTCGATGCTT
>probe:Drosophila_2:1631109_at:301:329; Interrogation_Position=4400; Antisense; GCGTACAGAGATTTGAGATTCCCTT
>probe:Drosophila_2:1631109_at:349:179; Interrogation_Position=4476; Antisense; AAACTAAATGCCAACTGCGCTGCGG
>probe:Drosophila_2:1631109_at:183:283; Interrogation_Position=4490; Antisense; CTGCGCTGCGGATCTTTACAAATTT

Paste this into a BLAST search page for me
GCTCACCGCATCTCAAGGTCGTAGAGTTACTGTGATCTCGCTGCTCAAAAAAACGAGTTGTACGATGCCCGGCTTTGCACTGCATCTCTTTGGTACTGAAAAGCCACTGCCCCTGGATACTGATAGATACTGATATCTCCGCCTTCGTAGGGCAGTGCCACGATCCGGAGTTCAAGCCTACGTCTGCAGAGATTCGGATTAGTACACTCTGGATGCCCTGAAGGATGAAGGACTACAGGCCCAACTACGATAACGCGGGCCATGATTCGATGCTTGCGTACAGAGATTTGAGATTCCCTTAAACTAAATGCCAACTGCGCTGCGGCTGCGCTGCGGATCTTTACAAATTT

Full Affymetrix probeset data:

Annotations for 1631109_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime