Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631110_at:

>probe:Drosophila_2:1631110_at:260:585; Interrogation_Position=1015; Antisense; TGGAAGGCTCCTCCATACGATACGA
>probe:Drosophila_2:1631110_at:486:375; Interrogation_Position=564; Antisense; GAAGACACCTTTCACATCGATCAGA
>probe:Drosophila_2:1631110_at:416:617; Interrogation_Position=594; Antisense; TGCATCATACGCGTTGATCCTGCGC
>probe:Drosophila_2:1631110_at:630:283; Interrogation_Position=613; Antisense; CTGCGCCGGGCTTCAAATACGAGTA
>probe:Drosophila_2:1631110_at:16:167; Interrogation_Position=657; Antisense; AAATCGCACGACCAGTACACCGAGG
>probe:Drosophila_2:1631110_at:416:385; Interrogation_Position=686; Antisense; GACACGGCAATATCGACTGTGGCTA
>probe:Drosophila_2:1631110_at:130:23; Interrogation_Position=710; Antisense; ATATACGGATGATGCGGCCGCCGAT
>probe:Drosophila_2:1631110_at:249:585; Interrogation_Position=766; Antisense; TGGACACGCTGAGTCTCTACGTAAA
>probe:Drosophila_2:1631110_at:192:663; Interrogation_Position=787; Antisense; TAAACGATGAGCTGCGCACCGAGGA
>probe:Drosophila_2:1631110_at:577:147; Interrogation_Position=810; Antisense; GAGTCGGTTTTTGTTCACGGCGGCA
>probe:Drosophila_2:1631110_at:40:107; Interrogation_Position=836; Antisense; AGACACCAAGTTCCTGCTGCAGGAC
>probe:Drosophila_2:1631110_at:392:399; Interrogation_Position=858; Antisense; GACACGGAATTCGTGCTTCAGGCAC
>probe:Drosophila_2:1631110_at:446:153; Interrogation_Position=899; Antisense; ACATGATGGCATCGTTCACACTCTG
>probe:Drosophila_2:1631110_at:94:213; Interrogation_Position=973; Antisense; AAGAGCCGGTCTCCATTTTGCAGAG

Paste this into a BLAST search page for me
TGGAAGGCTCCTCCATACGATACGAGAAGACACCTTTCACATCGATCAGATGCATCATACGCGTTGATCCTGCGCCTGCGCCGGGCTTCAAATACGAGTAAAATCGCACGACCAGTACACCGAGGGACACGGCAATATCGACTGTGGCTAATATACGGATGATGCGGCCGCCGATTGGACACGCTGAGTCTCTACGTAAATAAACGATGAGCTGCGCACCGAGGAGAGTCGGTTTTTGTTCACGGCGGCAAGACACCAAGTTCCTGCTGCAGGACGACACGGAATTCGTGCTTCAGGCACACATGATGGCATCGTTCACACTCTGAAGAGCCGGTCTCCATTTTGCAGAG

Full Affymetrix probeset data:

Annotations for 1631110_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime