FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631112_at:

>probe:Drosophila_2:1631112_at:347:347; Interrogation_Position=3482; Antisense; GCATCCGCATTAGCCTAAGCTACAG
>probe:Drosophila_2:1631112_at:114:265; Interrogation_Position=3504; Antisense; CAGTGTACTATATCTACGACCCGAC
>probe:Drosophila_2:1631112_at:78:137; Interrogation_Position=3519; Antisense; ACGACCCGACTAGGAACTATCTCAA
>probe:Drosophila_2:1631112_at:548:561; Interrogation_Position=3531; Antisense; GGAACTATCTCAATCTTCTAATGAA
>probe:Drosophila_2:1631112_at:394:611; Interrogation_Position=3552; Antisense; TGAACTGAAACCCAAACGCATTTTA
>probe:Drosophila_2:1631112_at:702:709; Interrogation_Position=3634; Antisense; TTGAAATTCGGCAATTCCCCGCGGA
>probe:Drosophila_2:1631112_at:607:187; Interrogation_Position=3680; Antisense; AACTTGGACGTGTGTGATACTAAAC
>probe:Drosophila_2:1631112_at:226:19; Interrogation_Position=3749; Antisense; ATTTCCCACAAACCATTACTCTATA
>probe:Drosophila_2:1631112_at:62:15; Interrogation_Position=3763; Antisense; ATTACTCTATAAATCCCGCGCGAGC
>probe:Drosophila_2:1631112_at:168:167; Interrogation_Position=3773; Antisense; AAATCCCGCGCGAGCTGGTAGAATA
>probe:Drosophila_2:1631112_at:480:465; Interrogation_Position=3807; Antisense; GTTGTACAACGTTTTCGAGAGCATG
>probe:Drosophila_2:1631112_at:79:1; Interrogation_Position=3908; Antisense; GCTACGTAGCGGATAAGTTACTTTA
>probe:Drosophila_2:1631112_at:600:697; Interrogation_Position=3953; Antisense; TTTCATTTGGTATTCCGTCACCCCA
>probe:Drosophila_2:1631112_at:261:271; Interrogation_Position=3976; Antisense; CATCTCCTTTTACGGCAACTTGGAA

Paste this into a BLAST search page for me
GCATCCGCATTAGCCTAAGCTACAGCAGTGTACTATATCTACGACCCGACACGACCCGACTAGGAACTATCTCAAGGAACTATCTCAATCTTCTAATGAATGAACTGAAACCCAAACGCATTTTATTGAAATTCGGCAATTCCCCGCGGAAACTTGGACGTGTGTGATACTAAACATTTCCCACAAACCATTACTCTATAATTACTCTATAAATCCCGCGCGAGCAAATCCCGCGCGAGCTGGTAGAATAGTTGTACAACGTTTTCGAGAGCATGGCTACGTAGCGGATAAGTTACTTTATTTCATTTGGTATTCCGTCACCCCACATCTCCTTTTACGGCAACTTGGAA

Full Affymetrix probeset data:

Annotations for 1631112_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720