FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631115_at:

>probe:Drosophila_2:1631115_at:575:9; Interrogation_Position=201; Antisense; ATTCGAGGATGCTGCCCATGTGCGT
>probe:Drosophila_2:1631115_at:322:63; Interrogation_Position=218; Antisense; ATGTGCGTCACTATCTCCATTGCTT
>probe:Drosophila_2:1631115_at:687:453; Interrogation_Position=23; Antisense; GATCACAGATCGGTTTGCTCAGCAG
>probe:Drosophila_2:1631115_at:222:7; Interrogation_Position=236; Antisense; ATTGCTTCTGGTCACGGCTGCAGCT
>probe:Drosophila_2:1631115_at:342:263; Interrogation_Position=256; Antisense; CAGCTCTGGCTGGATGAGACCGGAT
>probe:Drosophila_2:1631115_at:670:103; Interrogation_Position=272; Antisense; AGACCGGATTCCAGGCACAGCGCAT
>probe:Drosophila_2:1631115_at:720:155; Interrogation_Position=288; Antisense; ACAGCGCATCGTTCAGAGTTTCGGC
>probe:Drosophila_2:1631115_at:122:681; Interrogation_Position=306; Antisense; TTTCGGCGGCGAGAGGCGTCTCAAT
>probe:Drosophila_2:1631115_at:28:645; Interrogation_Position=324; Antisense; TCTCAATGTGGAGCAGGCACTGCCA
>probe:Drosophila_2:1631115_at:422:125; Interrogation_Position=348; Antisense; AGCCATCAACGGGTGCAATGCGAAA
>probe:Drosophila_2:1631115_at:326:199; Interrogation_Position=372; Antisense; AACGAGCTCCAGAGGATCGGGCGCT
>probe:Drosophila_2:1631115_at:326:41; Interrogation_Position=387; Antisense; ATCGGGCGCTCAGACAGTGGTCGAC
>probe:Drosophila_2:1631115_at:175:85; Interrogation_Position=402; Antisense; AGTGGTCGACTGGTGTTTCCGTGCC
>probe:Drosophila_2:1631115_at:282:539; Interrogation_Position=461; Antisense; GGTACAAGCGCCACATGTCCGATGT

Paste this into a BLAST search page for me
ATTCGAGGATGCTGCCCATGTGCGTATGTGCGTCACTATCTCCATTGCTTGATCACAGATCGGTTTGCTCAGCAGATTGCTTCTGGTCACGGCTGCAGCTCAGCTCTGGCTGGATGAGACCGGATAGACCGGATTCCAGGCACAGCGCATACAGCGCATCGTTCAGAGTTTCGGCTTTCGGCGGCGAGAGGCGTCTCAATTCTCAATGTGGAGCAGGCACTGCCAAGCCATCAACGGGTGCAATGCGAAAAACGAGCTCCAGAGGATCGGGCGCTATCGGGCGCTCAGACAGTGGTCGACAGTGGTCGACTGGTGTTTCCGTGCCGGTACAAGCGCCACATGTCCGATGT

Full Affymetrix probeset data:

Annotations for 1631115_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720