FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631116_at:

>probe:Drosophila_2:1631116_at:308:75; Interrogation_Position=1017; Antisense; AGGACGCTCTGCTCTGTATGATTAG
>probe:Drosophila_2:1631116_at:448:79; Interrogation_Position=1063; Antisense; AGGTCGAAAGCGGTCTGCATAGTCC
>probe:Drosophila_2:1631116_at:88:619; Interrogation_Position=1078; Antisense; TGCATAGTCCGCTGTGTAGTCCAGA
>probe:Drosophila_2:1631116_at:319:677; Interrogation_Position=1094; Antisense; TAGTCCAGAGGTCGTAGGTTCCCAA
>probe:Drosophila_2:1631116_at:190:719; Interrogation_Position=1120; Antisense; TTCCGCAGGCGAACGTTTCAATCAT
>probe:Drosophila_2:1631116_at:591:183; Interrogation_Position=1190; Antisense; AAAAGTCCCTAGAACTGCCAGTAGA
>probe:Drosophila_2:1631116_at:729:139; Interrogation_Position=695; Antisense; ACGTGCCACTATTGCGGCGAGCTGG
>probe:Drosophila_2:1631116_at:347:251; Interrogation_Position=724; Antisense; CAAGGCCAACTCGTGCAAGCAGTAT
>probe:Drosophila_2:1631116_at:588:353; Interrogation_Position=753; Antisense; GCAGCCTGGAGCATCGCAACAATAT
>probe:Drosophila_2:1631116_at:345:23; Interrogation_Position=774; Antisense; ATATCAACGCAATGGATCACTCCGG
>probe:Drosophila_2:1631116_at:268:535; Interrogation_Position=842; Antisense; GGTGCCGATGACATGCAATCCAATC
>probe:Drosophila_2:1631116_at:523:427; Interrogation_Position=920; Antisense; GAGATCACCTGCTACAAGTGCGGGA
>probe:Drosophila_2:1631116_at:516:527; Interrogation_Position=941; Antisense; GGGAACAAGGGCCACTACGCGAACA
>probe:Drosophila_2:1631116_at:44:671; Interrogation_Position=956; Antisense; TACGCGAACAAGTGTCCCAAGGGTC

Paste this into a BLAST search page for me
AGGACGCTCTGCTCTGTATGATTAGAGGTCGAAAGCGGTCTGCATAGTCCTGCATAGTCCGCTGTGTAGTCCAGATAGTCCAGAGGTCGTAGGTTCCCAATTCCGCAGGCGAACGTTTCAATCATAAAAGTCCCTAGAACTGCCAGTAGAACGTGCCACTATTGCGGCGAGCTGGCAAGGCCAACTCGTGCAAGCAGTATGCAGCCTGGAGCATCGCAACAATATATATCAACGCAATGGATCACTCCGGGGTGCCGATGACATGCAATCCAATCGAGATCACCTGCTACAAGTGCGGGAGGGAACAAGGGCCACTACGCGAACATACGCGAACAAGTGTCCCAAGGGTC

Full Affymetrix probeset data:

Annotations for 1631116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720