Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631122_at:

>probe:Drosophila_2:1631122_at:169:211; Interrogation_Position=2916; Antisense; AAGAAGTGTCGGCAGCAGCACAGCT
>probe:Drosophila_2:1631122_at:689:351; Interrogation_Position=2930; Antisense; GCAGCACAGCTAATAGTATTCACGT
>probe:Drosophila_2:1631122_at:172:675; Interrogation_Position=3005; Antisense; TAGCAAACATTAGGCGCCCAGTGAA
>probe:Drosophila_2:1631122_at:558:183; Interrogation_Position=3032; Antisense; AAAAGCAGCTGCTGCTCGTCGCAAA
>probe:Drosophila_2:1631122_at:692:705; Interrogation_Position=3078; Antisense; TTAGGGTTCGATTCTTCCCAGCCGA
>probe:Drosophila_2:1631122_at:350:275; Interrogation_Position=3091; Antisense; CTTCCCAGCCGAAACTAACAATCAA
>probe:Drosophila_2:1631122_at:140:247; Interrogation_Position=3114; Antisense; AATTCCAGGCATTTCCATTCGTTTA
>probe:Drosophila_2:1631122_at:468:61; Interrogation_Position=3230; Antisense; ATGTGCTTTATGCAGTCACGTTAAA
>probe:Drosophila_2:1631122_at:724:173; Interrogation_Position=3253; Antisense; AAAGCGTTGTCATTCATGTATCTAT
>probe:Drosophila_2:1631122_at:560:125; Interrogation_Position=3298; Antisense; AGCCGTGACATGAAGCACAGGTCCT
>probe:Drosophila_2:1631122_at:674:355; Interrogation_Position=3312; Antisense; GCACAGGTCCTGCTAGTAGCGTGTA
>probe:Drosophila_2:1631122_at:601:485; Interrogation_Position=3327; Antisense; GTAGCGTGTAGTTGAAAGCCATTTT
>probe:Drosophila_2:1631122_at:628:391; Interrogation_Position=3340; Antisense; GAAAGCCATTTTATCGAGTCATTGA
>probe:Drosophila_2:1631122_at:542:31; Interrogation_Position=3421; Antisense; ATAACTGTGCACATACTTCATATTG

Paste this into a BLAST search page for me
AAGAAGTGTCGGCAGCAGCACAGCTGCAGCACAGCTAATAGTATTCACGTTAGCAAACATTAGGCGCCCAGTGAAAAAAGCAGCTGCTGCTCGTCGCAAATTAGGGTTCGATTCTTCCCAGCCGACTTCCCAGCCGAAACTAACAATCAAAATTCCAGGCATTTCCATTCGTTTAATGTGCTTTATGCAGTCACGTTAAAAAAGCGTTGTCATTCATGTATCTATAGCCGTGACATGAAGCACAGGTCCTGCACAGGTCCTGCTAGTAGCGTGTAGTAGCGTGTAGTTGAAAGCCATTTTGAAAGCCATTTTATCGAGTCATTGAATAACTGTGCACATACTTCATATTG

Full Affymetrix probeset data:

Annotations for 1631122_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime