FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631123_at:

>probe:Drosophila_2:1631123_at:477:627; Interrogation_Position=3570; Antisense; TGCCACGCGTGTTGCTTTCCATGAA
>probe:Drosophila_2:1631123_at:562:609; Interrogation_Position=3591; Antisense; TGAACACCTATTGCCCGTATGTTTG
>probe:Drosophila_2:1631123_at:193:321; Interrogation_Position=3618; Antisense; GCCGCCAAGCGTGAGGAATCTGCAT
>probe:Drosophila_2:1631123_at:130:547; Interrogation_Position=3690; Antisense; GGATCCCAAATCCACGTACGAGTAC
>probe:Drosophila_2:1631123_at:379:679; Interrogation_Position=3716; Antisense; TAGTCAACGAGGTGCAAGTGCCCAT
>probe:Drosophila_2:1631123_at:728:219; Interrogation_Position=3731; Antisense; AAGTGCCCATCATCACGCGTAATCA
>probe:Drosophila_2:1631123_at:47:87; Interrogation_Position=3755; Antisense; AGTGCGACGAATGGCTGGACAACCT
>probe:Drosophila_2:1631123_at:10:161; Interrogation_Position=3773; Antisense; ACAACCTGACGGTGTCGGAGGGCAT
>probe:Drosophila_2:1631123_at:594:499; Interrogation_Position=3941; Antisense; GTCTGCCGGGCGTATATGCAAACGT
>probe:Drosophila_2:1631123_at:282:377; Interrogation_Position=4002; Antisense; GAAGCATTCGCGTCCCATTAAAGAG
>probe:Drosophila_2:1631123_at:426:437; Interrogation_Position=4024; Antisense; GAGGACCGCGTTAACAAGTATGACC
>probe:Drosophila_2:1631123_at:27:217; Interrogation_Position=4039; Antisense; AAGTATGACCTGCATCCCGGAGGAC
>probe:Drosophila_2:1631123_at:292:533; Interrogation_Position=4057; Antisense; GGAGGACCCGATATACTATCCAAAA
>probe:Drosophila_2:1631123_at:702:163; Interrogation_Position=4079; Antisense; AAATAGCCACTGACCCTATGCGCGA

Paste this into a BLAST search page for me
TGCCACGCGTGTTGCTTTCCATGAATGAACACCTATTGCCCGTATGTTTGGCCGCCAAGCGTGAGGAATCTGCATGGATCCCAAATCCACGTACGAGTACTAGTCAACGAGGTGCAAGTGCCCATAAGTGCCCATCATCACGCGTAATCAAGTGCGACGAATGGCTGGACAACCTACAACCTGACGGTGTCGGAGGGCATGTCTGCCGGGCGTATATGCAAACGTGAAGCATTCGCGTCCCATTAAAGAGGAGGACCGCGTTAACAAGTATGACCAAGTATGACCTGCATCCCGGAGGACGGAGGACCCGATATACTATCCAAAAAAATAGCCACTGACCCTATGCGCGA

Full Affymetrix probeset data:

Annotations for 1631123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720