FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631125_at:

>probe:Drosophila_2:1631125_at:34:47; Interrogation_Position=4568; Antisense; ATCCCATATCCGGTCAGCAGCGAAG
>probe:Drosophila_2:1631125_at:261:427; Interrogation_Position=4607; Antisense; GAGATGGTGCTAATCCAGTGCCCAG
>probe:Drosophila_2:1631125_at:161:87; Interrogation_Position=4623; Antisense; AGTGCCCAGCACGTTGAACCCAGAT
>probe:Drosophila_2:1631125_at:565:613; Interrogation_Position=4637; Antisense; TGAACCCAGATGCAGCGTCGACCTT
>probe:Drosophila_2:1631125_at:48:635; Interrogation_Position=4654; Antisense; TCGACCTTTGCCGAAACGACTGCAG
>probe:Drosophila_2:1631125_at:517:405; Interrogation_Position=4671; Antisense; GACTGCAGCGCATGTCGCCTAATTG
>probe:Drosophila_2:1631125_at:508:503; Interrogation_Position=4684; Antisense; GTCGCCTAATTGTAGCCCTTTAAAT
>probe:Drosophila_2:1631125_at:112:111; Interrogation_Position=4837; Antisense; AGAATCCGAACCGAATCATCCGTAC
>probe:Drosophila_2:1631125_at:264:393; Interrogation_Position=4874; Antisense; GAAAGCAGCCCGACTGGAATCGAAT
>probe:Drosophila_2:1631125_at:688:707; Interrogation_Position=4965; Antisense; TTAAACACTCGAATTGTTTGCTCGC
>probe:Drosophila_2:1631125_at:680:479; Interrogation_Position=4980; Antisense; GTTTGCTCGCATTCCATTAATTATT
>probe:Drosophila_2:1631125_at:174:693; Interrogation_Position=5000; Antisense; TTATTGTAAACAGCCACGGAGGTGT
>probe:Drosophila_2:1631125_at:274:81; Interrogation_Position=5019; Antisense; AGGTGTGCGATGTTCGTTCCTCCAG
>probe:Drosophila_2:1631125_at:50:719; Interrogation_Position=5035; Antisense; TTCCTCCAGTGGTGTGTATGTATCT

Paste this into a BLAST search page for me
ATCCCATATCCGGTCAGCAGCGAAGGAGATGGTGCTAATCCAGTGCCCAGAGTGCCCAGCACGTTGAACCCAGATTGAACCCAGATGCAGCGTCGACCTTTCGACCTTTGCCGAAACGACTGCAGGACTGCAGCGCATGTCGCCTAATTGGTCGCCTAATTGTAGCCCTTTAAATAGAATCCGAACCGAATCATCCGTACGAAAGCAGCCCGACTGGAATCGAATTTAAACACTCGAATTGTTTGCTCGCGTTTGCTCGCATTCCATTAATTATTTTATTGTAAACAGCCACGGAGGTGTAGGTGTGCGATGTTCGTTCCTCCAGTTCCTCCAGTGGTGTGTATGTATCT

Full Affymetrix probeset data:

Annotations for 1631125_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720