Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631126_at:

>probe:Drosophila_2:1631126_at:237:23; Interrogation_Position=1638; Antisense; ATATCACCCAGTCAACAGCACGGAT
>probe:Drosophila_2:1631126_at:369:353; Interrogation_Position=1655; Antisense; GCACGGATCCCATCTATTGCTAGGG
>probe:Drosophila_2:1631126_at:27:531; Interrogation_Position=1684; Antisense; GGGATAAGATCTCTCATCGCAACTA
>probe:Drosophila_2:1631126_at:614:359; Interrogation_Position=1702; Antisense; GCAACTACTATTACTGAGCCACTCA
>probe:Drosophila_2:1631126_at:206:145; Interrogation_Position=1722; Antisense; ACTCAAGCGTTGTTCTAGTCCCTAG
>probe:Drosophila_2:1631126_at:68:679; Interrogation_Position=1737; Antisense; TAGTCCCTAGTTGATTGATTTCCAT
>probe:Drosophila_2:1631126_at:109:605; Interrogation_Position=1752; Antisense; TGATTTCCATTCATGTTCCCATTGC
>probe:Drosophila_2:1631126_at:237:717; Interrogation_Position=1767; Antisense; TTCCCATTGCTTGTTGGTCGTGTAT
>probe:Drosophila_2:1631126_at:278:601; Interrogation_Position=1831; Antisense; TGTTTCCCAGCTATTCCAAAGTTTT
>probe:Drosophila_2:1631126_at:411:429; Interrogation_Position=1892; Antisense; GAGTTTTAAGTCACATTTCCCACCT
>probe:Drosophila_2:1631126_at:442:493; Interrogation_Position=1901; Antisense; GTCACATTTCCCACCTATTTATGAA
>probe:Drosophila_2:1631126_at:459:155; Interrogation_Position=1992; Antisense; ACACGTGTCAAGCAAGGGAGCTCGT
>probe:Drosophila_2:1631126_at:450:527; Interrogation_Position=2007; Antisense; GGGAGCTCGTAATCATTGTCAGTAT
>probe:Drosophila_2:1631126_at:642:481; Interrogation_Position=2028; Antisense; GTATAACATTACCAGCGGCAGGATA

Paste this into a BLAST search page for me
ATATCACCCAGTCAACAGCACGGATGCACGGATCCCATCTATTGCTAGGGGGGATAAGATCTCTCATCGCAACTAGCAACTACTATTACTGAGCCACTCAACTCAAGCGTTGTTCTAGTCCCTAGTAGTCCCTAGTTGATTGATTTCCATTGATTTCCATTCATGTTCCCATTGCTTCCCATTGCTTGTTGGTCGTGTATTGTTTCCCAGCTATTCCAAAGTTTTGAGTTTTAAGTCACATTTCCCACCTGTCACATTTCCCACCTATTTATGAAACACGTGTCAAGCAAGGGAGCTCGTGGGAGCTCGTAATCATTGTCAGTATGTATAACATTACCAGCGGCAGGATA

Full Affymetrix probeset data:

Annotations for 1631126_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime