FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631127_at:

>probe:Drosophila_2:1631127_at:378:403; Interrogation_Position=1006; Antisense; GACTTTGAACTAATTCCAGCTGTTT
>probe:Drosophila_2:1631127_at:584:575; Interrogation_Position=1045; Antisense; GGCGACCATTAACCGAATTTTCAAT
>probe:Drosophila_2:1631127_at:250:631; Interrogation_Position=655; Antisense; TCCTGGGAGCCGGAGTAACTGTCCT
>probe:Drosophila_2:1631127_at:588:523; Interrogation_Position=686; Antisense; GGGCGCCAACGACAAGATCTATCTC
>probe:Drosophila_2:1631127_at:16:137; Interrogation_Position=721; Antisense; ACGAAGTTCACTCAATGCCTAGCGG
>probe:Drosophila_2:1631127_at:669:585; Interrogation_Position=767; Antisense; TGGACAAGGTGACCTGCTCTCCGGA
>probe:Drosophila_2:1631127_at:725:589; Interrogation_Position=813; Antisense; TGGTCACTGCAGTCGGGTGAACCCA
>probe:Drosophila_2:1631127_at:582:235; Interrogation_Position=837; Antisense; AATCCCGCCCTGGTAGCTGCATGTG
>probe:Drosophila_2:1631127_at:98:349; Interrogation_Position=855; Antisense; GCATGTGCCTCTAGTTACTTTGTGA
>probe:Drosophila_2:1631127_at:299:473; Interrogation_Position=884; Antisense; GTTAAACGCGGCTGCATTTCAAAAG
>probe:Drosophila_2:1631127_at:422:17; Interrogation_Position=899; Antisense; ATTTCAAAAGTTTGGCCGCAGCCTA
>probe:Drosophila_2:1631127_at:596:125; Interrogation_Position=918; Antisense; AGCCTACTGGCCAGTGACATGGTCA
>probe:Drosophila_2:1631127_at:675:27; Interrogation_Position=948; Antisense; ATACCCAGCGTATTTCAGACCGAGT
>probe:Drosophila_2:1631127_at:468:389; Interrogation_Position=975; Antisense; GAAAACAGCGATCCTCAATAGTCAT

Paste this into a BLAST search page for me
GACTTTGAACTAATTCCAGCTGTTTGGCGACCATTAACCGAATTTTCAATTCCTGGGAGCCGGAGTAACTGTCCTGGGCGCCAACGACAAGATCTATCTCACGAAGTTCACTCAATGCCTAGCGGTGGACAAGGTGACCTGCTCTCCGGATGGTCACTGCAGTCGGGTGAACCCAAATCCCGCCCTGGTAGCTGCATGTGGCATGTGCCTCTAGTTACTTTGTGAGTTAAACGCGGCTGCATTTCAAAAGATTTCAAAAGTTTGGCCGCAGCCTAAGCCTACTGGCCAGTGACATGGTCAATACCCAGCGTATTTCAGACCGAGTGAAAACAGCGATCCTCAATAGTCAT

Full Affymetrix probeset data:

Annotations for 1631127_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720