Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631128_s_at:

>probe:Drosophila_2:1631128_s_at:529:113; Interrogation_Position=131; Antisense; AGCATGGACGGCTTCTACAGCAACA
>probe:Drosophila_2:1631128_s_at:254:195; Interrogation_Position=209; Antisense; AACTGCGGATCGTGTGGCAACTGCC
>probe:Drosophila_2:1631128_s_at:592:393; Interrogation_Position=348; Antisense; GAAAGTCGCGCTTCAATCCAGACTG
>probe:Drosophila_2:1631128_s_at:190:143; Interrogation_Position=369; Antisense; ACTGGCAGTATGGTGGACGCTAGCA
>probe:Drosophila_2:1631128_s_at:200:159; Interrogation_Position=396; Antisense; AAAGAGTTAGCGCTTCCCAGACCTG
>probe:Drosophila_2:1631128_s_at:583:163; Interrogation_Position=422; Antisense; AAATCGAACGCCCACGAATGGACTT
>probe:Drosophila_2:1631128_s_at:575:271; Interrogation_Position=455; Antisense; CATCTTACCGGAATAGCTGCACACA
>probe:Drosophila_2:1631128_s_at:566:121; Interrogation_Position=512; Antisense; AGCGGATCCGCTGGTCGACTCGGAA
>probe:Drosophila_2:1631128_s_at:30:637; Interrogation_Position=526; Antisense; TCGACTCGGAAACTTGCACCCATAT
>probe:Drosophila_2:1631128_s_at:332:707; Interrogation_Position=598; Antisense; TTACCATCTACACTTACCATCTACA
>probe:Drosophila_2:1631128_s_at:57:155; Interrogation_Position=620; Antisense; ACACTTACCATCTAGACTTACCATC
>probe:Drosophila_2:1631128_s_at:333:707; Interrogation_Position=637; Antisense; TTACCATCTACACTTTCCACATACA
>probe:Drosophila_2:1631128_s_at:679:149; Interrogation_Position=655; Antisense; ACATACACTTTCCATTCACGCATAA
>probe:Drosophila_2:1631128_s_at:560:343; Interrogation_Position=674; Antisense; GCATAAATTACCAATATCCCCGACG

Paste this into a BLAST search page for me
AGCATGGACGGCTTCTACAGCAACAAACTGCGGATCGTGTGGCAACTGCCGAAAGTCGCGCTTCAATCCAGACTGACTGGCAGTATGGTGGACGCTAGCAAAAGAGTTAGCGCTTCCCAGACCTGAAATCGAACGCCCACGAATGGACTTCATCTTACCGGAATAGCTGCACACAAGCGGATCCGCTGGTCGACTCGGAATCGACTCGGAAACTTGCACCCATATTTACCATCTACACTTACCATCTACAACACTTACCATCTAGACTTACCATCTTACCATCTACACTTTCCACATACAACATACACTTTCCATTCACGCATAAGCATAAATTACCAATATCCCCGACG

Full Affymetrix probeset data:

Annotations for 1631128_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime