Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631129_at:

>probe:Drosophila_2:1631129_at:179:83; Interrogation_Position=2751; Antisense; AGTGGTTTTCGTGCGATCAATGCGA
>probe:Drosophila_2:1631129_at:487:327; Interrogation_Position=2763; Antisense; GCGATCAATGCGATTTCAGAGCCCG
>probe:Drosophila_2:1631129_at:681:697; Interrogation_Position=2776; Antisense; TTTCAGAGCCCGCATCAAGGGTCAC
>probe:Drosophila_2:1631129_at:616:509; Interrogation_Position=2866; Antisense; GTGCAGCACCATAGATAACCTACGT
>probe:Drosophila_2:1631129_at:716:659; Interrogation_Position=2881; Antisense; TAACCTACGTAAGCACATCATCAAG
>probe:Drosophila_2:1631129_at:411:355; Interrogation_Position=2893; Antisense; GCACATCATCAAGACGGGAAAGCAT
>probe:Drosophila_2:1631129_at:315:171; Interrogation_Position=2911; Antisense; AAAGCATCCCGGCATGTTCATTTAC
>probe:Drosophila_2:1631129_at:240:289; Interrogation_Position=2920; Antisense; CGGCATGTTCATTTACCACTGCGCT
>probe:Drosophila_2:1631129_at:13:145; Interrogation_Position=2937; Antisense; ACTGCGCTAAGTGCTCCGATGAAGA
>probe:Drosophila_2:1631129_at:519:365; Interrogation_Position=2996; Antisense; GAATACCAGCACCACTTGAAGACTC
>probe:Drosophila_2:1631129_at:652:375; Interrogation_Position=3013; Antisense; GAAGACTCACAAGGCTGGCTGAGAA
>probe:Drosophila_2:1631129_at:331:33; Interrogation_Position=3083; Antisense; ATCAACATCCTAATATCCTTTCATT
>probe:Drosophila_2:1631129_at:198:227; Interrogation_Position=3277; Antisense; AAGGCATGGCTTTATCAAGAACGTC
>probe:Drosophila_2:1631129_at:303:253; Interrogation_Position=3292; Antisense; CAAGAACGTCATTGGTTGTACATAA

Paste this into a BLAST search page for me
AGTGGTTTTCGTGCGATCAATGCGAGCGATCAATGCGATTTCAGAGCCCGTTTCAGAGCCCGCATCAAGGGTCACGTGCAGCACCATAGATAACCTACGTTAACCTACGTAAGCACATCATCAAGGCACATCATCAAGACGGGAAAGCATAAAGCATCCCGGCATGTTCATTTACCGGCATGTTCATTTACCACTGCGCTACTGCGCTAAGTGCTCCGATGAAGAGAATACCAGCACCACTTGAAGACTCGAAGACTCACAAGGCTGGCTGAGAAATCAACATCCTAATATCCTTTCATTAAGGCATGGCTTTATCAAGAACGTCCAAGAACGTCATTGGTTGTACATAA

Full Affymetrix probeset data:

Annotations for 1631129_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime